Practice Questions

  1. Home
  2. Free Resources
  3. Practice Questions
  4. 47523
TLS Online TPP Program

#Question id: 3889

The operator region normally can be bound by:

#SCPH28 | Zoology

  1. attenuator.

  2. inducer.

  3. mRNA.

  4. repressor.

More Questions
TLS Online TPP Program

#Question id: 10987

#SCPH28 | Zoology

If the ventricular Purkinje fibers become the pacemaker of the heart, what is the expected heart rate?
TLS Online TPP Program

#Question id: 4757

#SCPH12 I Genetics

The newborn baby of a mother having blood group O, Rh+ and father having blood group AB, Rh-, got mixed with other babies in the hospital. The baby with which of the following blood groups is not confirmable to be of the said couple?

(i) AB, Rh+                                                    (ii) O, Rh+

(iii) A, Rh+                                         (iv)  B, Rh+
TLS Online TPP Program

#Question id: 13101

#SCPH28 | Zoology

You are a scientist who is using genomics to currently study a new bacterial species that no one has ever studied before. The following sequence is a piece of DNA within the coding region of a gene that you have recently sequenced.
 
You are using shotgun sequencing to determine the DNA sequence of the genome of this new bacterial species. For one strand of a 30-nucleotide long stretch of DNA, you get the following sequences out of your shotgun sequencing reaction. Assemble the entire 30-nt-long DNA sequence
 
5’-TGGGAGTTCCTCAAACGCGTTGTCACTGAC-3’
You put the DNA sequence that you have assembled into a computer program that tells you that the following piece of DNA, which comes from another bacterium, is a close match to the sequence you have sequenced from your bacterium: 5’-…TGGGCATTTCTCAAGCGGGTTGTAATGGAT…-3’
This 30-nt-long sequence fragment lies in the center of a gene, and that portion of the sequence encodes for this 10-amino acid-long part of a protein:
N-…Trp-Ala-Phe-Leu-Lys-Arg-Val-Val-Met-Asp…-C
You hypothesize that the sequence you have discovered is another bacterial species’ version of the same gene as this previously known gene. To measure how identical the two genes are at the DNA level and/or the two proteins are at the amino acid level, you can calculate a percentage of “identity” for each. This is the percent of nucleotides (for the gene) or the percent of amino acids (for the protein) that are identical between the two sequences.
What is the % identity between the two protein sequences?
TLS Online TPP Program

#Question id: 2705

#SCPH05 I Biotechnology

With respect to end terminal modification of the histone tail which of the following options is true?
TLS Online TPP Program

#Question id: 4812

#SCPH12 I Genetics

Two character X and Y ,both follow law of dominance due to 3:1 F2 phenotypic ratio monohybrid cross separately If carry out dihybrid selfing cross for heterozygous genotype for both character does not follow law of independence assortment in normal environmental condition due to?