How many GTP are hydrolyzed for every aminoacyl-tRNA that is successfully inserted into the A site of the ribosome?

TLS Online TPP Program

#Question id: 23249

#SCPH28 | Zoology

Which enzyme converts the PPi to ATP in Pyrosequencing?

TLS Online TPP Program

#Question id: 14118

#SCPH01 Biochemistry

Identify the file format given below:

>KX580312.1 Homo sapiens truncated breast cancer 1 (BRCA1) gene, exon 15 and partial cds

GTCATCCCCTTCTAAATGCCCATCATTAGATGATAGGTGGTACATGCACAGTTGCTCTGGGAGTCTTCAG

AATAGAAACTACCCATCTCAAGAGGAGCTCATTAAGGTTGTTGATGTGGAGGAGTAACAGCTGGAAGAGT

CTGGGCCACACGATTTGACGGAAACATCTTACTTGCCAAGGCAAGATCTAG

TLS Online TPP Program

#Question id: 4738

#SCPH06 I Botany

Red kernel color in wheat results from the presence of at least one dominant allele of each of two independently segregating genes . Kernels on rr bb plants are white, and the genotypes R— bb and rr B— result in brown kernel color. Suppose that plants of a variety that is true breeding for red kernels are crossed with plants true breeding for white kernels produced F1 were allowed to selfing .what are F2 phenotype ratio ?

TLS Online TPP Program

#Question id: 40

#SCPH06 I Botany

Given that the standard free-energy change for the reaction glucose + Pi → glucose 6-phosphate is 13.8 kJ/mol, and the standard free-energy change for the reaction ATP → ADP + Pi is −30.5 kJ/mol, what is the free-energy change for the reaction glucose + ATP → glucose 6-phosphate + ADP?

TLS Online TPP Program

#Question id: 4162

#SCPH01 Biochemistry

Which statement is false concerning aminoacyl-tRNA synthetase?