Practice Questions

  1. Home
  2. Free Resources
  3. Practice Questions
  4. 47778
TLS Online TPP Program

#Question id: 1065

Resistance of some animals to certain viral diseases is based on

#SCPH28 | Zoology

  1. lack of spikes for attachment.

  2. phagocytosis of the virus by the host cell.

  3. the presence of the viral envelope.

  4. lack of specific receptors on the host cell.

More Questions
TLS Online TPP Program

#Question id: 466

#SCPH05 I Biotechnology

When a reduction half-reaction is ________ (negative, positive), electrons flow to the more readily reduced substance which is ________ (negative, positive) in value.
TLS Online TPP Program

#Question id: 13096

#SCPH05 I Biotechnology

You are practicing designing primers that you can use in PCR reactions. You want your primers to allow you to amplify the sequence found below.
 

 
(a) 5’-ACTTCGATATGTCTAAAATAC-3’ and 5’- CGGTAGCGTCTCTGGTTAGCT -3’
(b) 5’-TGAAGCTATACAGATTTTATG-3’ and 5’-GCCATCGCAGAGACCAATCGA-3’
(c) 5’-GTATTTTAGACATATCGAAGT -3’ and 5’-AGCTAACCAGAGACGCTACCG-3’
You are asked to design a 15-nucleotide-long primer that could potentially hybridize to a portion of a specific mRNA that encodes the protein sequence N-Met-Ala-Tyr-Trp-Pro-C. How many different primers would you have to design in order to ensure that one of them will in fact hybridize along its full length to the mRNA?
TLS Online TPP Program

#Question id: 3254

#SCPH28 | Zoology

Consider a single locus with 2 alleles which are at Hardy-Weinberg equilibrium. If the frequency of the heterozygous genotypes is 0.42, what is the frequency of one homozygote in the population?
TLS Online TPP Program

#Question id: 5528

#SCPH06 I Botany

The lining of the uterus in which the mammalian embryo implantationsTakes place called as
TLS Online TPP Program

#Question id: 11405

#SCPH06 I Botany

Vulnerability to extinction can be linked to species following characteristics. Which of the following statement are correct?

A. Endemism species are more prone to extinction than fragmented

B. Species that are capable of migrating between fragments of habitat, such as between mainland areas and islands, may be more resistant to extinction

C. Population variability species are less prone to extinct

D. Species with naturally long life spans may be more likely to become extinct