Which of the following mutations would promote malignancy in cells whose proliferation is inhibited by TGFβ?

a. overexpression of Smad2               

b. loss of Smad 4

c. overexpression of TGFβ receptor I

d. loss of TGFβ receptor II

TLS Online TPP Program

#Question id: 10708

#SCPH28 | Zoology

Which of the following statements is a likely explanation for why invasive species take over communities into which they have been introduced?

TLS Online TPP Program

#Question id: 1587

#I Life Science/ Life Sciences Group – I-V

In the human disease known as lupus, there is an immune reaction against a patientʹs own DNA from broken or dying cells. This kind of response typifies which kind of irregularity?

TLS Online TPP Program

#Question id: 11145

#I Life Science/ Life Sciences Group – I-V

Two fundamental concepts about the ion channels of a "resting" neuron are that the channels ________.

TLS Online TPP Program

#Question id: 5765

#SCPH28 | Zoology

How many different trisomics could be formed in a plant with a diploid number of 12?

TLS Online TPP Program

#Question id: 13095

#SCPH28 | Zoology

You are practicing designing primers that you can use in PCR reactions. You want your primers to allow you to amplify the sequence found below.

 

 

 (a) 5’-ACTTCGATATGTCTAAAATAC-3’ and 5’- CGGTAGCGTCTCTGGTTAGCT -3’

(b) 5’-TGAAGCTATACAGATTTTATG-3’ and 5’-GCCATCGCAGAGACCAATCGA-3’

(c) 5’-GTATTTTAGACATATCGAAGT -3’ and 5’-AGCTAACCAGAGACGCTACCG-3’

Find the correct band pattern in gel lanes what size(s) of PCR products you would get if you used the following primers stated in parts (a), (b), and (c) to do a PCR reaction on the template DNA shown above.