TLS Online TPP Program

#Question id: 1543


Effector  cytokines of TH 1 cells?

#SCPH28 | Zoology
  1. IFN-ϒ

  2. TNF

  3. IL-21

  4. IFN-ϒ, TNF

More Questions
TLS Online TPP Program

#Question id: 2144

#SCPH06 I Botany

The type of membrane transport that uses ion gradients as the energy source is:

TLS Online TPP Program

#Question id: 1617

#SCPH05 I Biotechnology

Which of the following statements is TRUE of lysozyme?

TLS Online TPP Program

#Question id: 12669

#SCPH06 I Botany

Water potential of plants under various growing conditions, and sensitivity of various physiological processes to water potential, during  water potential  0→ -1 MPa,  which of the following  physiological condition will not be seen ;

TLS Online TPP Program

#Question id: 13096

#SCPH28 | Zoology

You are practicing designing primers that you can use in PCR reactions. You want your primers to allow you to amplify the sequence found below.
 

 
(a) 5’-ACTTCGATATGTCTAAAATAC-3’ and 5’- CGGTAGCGTCTCTGGTTAGCT -3’
(b) 5’-TGAAGCTATACAGATTTTATG-3’ and 5’-GCCATCGCAGAGACCAATCGA-3’
(c) 5’-GTATTTTAGACATATCGAAGT -3’ and 5’-AGCTAACCAGAGACGCTACCG-3’
You are asked to design a 15-nucleotide-long primer that could potentially hybridize to a portion of a specific mRNA that encodes the protein sequence N-Met-Ala-Tyr-Trp-Pro-C. How many different primers would you have to design in order to ensure that one of them will in fact hybridize along its full length to the mRNA?

TLS Online TPP Program

#Question id: 15618

#SCPH28 | Zoology

Wild type E. coli metabolizes the sugar lactose by expressing the enzyme ß-galactosidase. You have isolated a mutant that you call lac1-, which cannot synthesize ß-galactosidase and cannot grow on lactose (Lac-). During an condition  isolate  a second Lac– mutation, which you designate lac2-. Using P1 phage on this strain and use the resulting phage lysate to infect the lac2- strain, selecting for   Kanr   transductants. In this case, all 100   Kanr   transductants that are examined are Lac–. What does this result tell you about the relationship between the lac1- and lac2- mutations?