The initial complement component activated by complement-fixing antibodies is:

TLS Online TPP Program

#Question id: 14118

#SCPH05 I Biotechnology

Identify the file format given below:

>KX580312.1 Homo sapiens truncated breast cancer 1 (BRCA1) gene, exon 15 and partial cds

GTCATCCCCTTCTAAATGCCCATCATTAGATGATAGGTGGTACATGCACAGTTGCTCTGGGAGTCTTCAG

AATAGAAACTACCCATCTCAAGAGGAGCTCATTAAGGTTGTTGATGTGGAGGAGTAACAGCTGGAAGAGT

CTGGGCCACACGATTTGACGGAAACATCTTACTTGCCAAGGCAAGATCTAG

TLS Online TPP Program

#Question id: 11274

#SCPH28 | Zoology

Assimilation efficiency (AE) is the proportion of ingested energy assimilated in to blood stream but Production efficiency (PE) is the proportion of assimilated energy that is incorporated in to biomass. Following some statement is correct?

A. Assimilation efficiencies of aquatic herbivore is greater than terrestrial herbivore

B. Production efficiencies of higher tropic level are greater than lower tropic level

C. production efficiencies of vertebrate is less than invertebrate

D. Assimilation efficiencies of Carnivore are often greater than herbivore

TLS Online TPP Program

#Question id: 9238

#SCPH06 I Botany

Which of the following is a consequence of biological magnification?

TLS Online TPP Program

#Question id: 1613

#SCPH05 I Biotechnology

Complement component C3 is cleaved by:

TLS Online TPP Program

#Question id: 1427

#SCPH28 | Zoology

 In females, all the cells in a tumor have the same inactive X chromosome. The reason for this is that: