Ectoderm cells related with anterior neural crest cells condense and form

TLS Online TPP Program

#Question id: 448

#SCPH06 I Botany

During glycolysis, glucose 1-phosphate is converted to fructose 6-phosphate in two successive reactions: Glucose 1-phosphate -> glucose 6-phosphate DG'° = –7.1 kJ/mol Glucose 6-phosphate -> fructose 6-phosphate DG'° = +1.7 kJ/mol DG'° for the overall reaction is:

TLS Online TPP Program

#Question id: 351

#SCPH06 I Botany

 If the cytoplasm of a cell is at pH 7, and the mitochondrial matrix is at pH 8, then the concentration of H+ ions ________.

TLS Online TPP Program

#Question id: 13095

#SCPH01 Biochemistry

You are practicing designing primers that you can use in PCR reactions. You want your primers to allow you to amplify the sequence found below.

 

 

 (a) 5’-ACTTCGATATGTCTAAAATAC-3’ and 5’- CGGTAGCGTCTCTGGTTAGCT -3’

(b) 5’-TGAAGCTATACAGATTTTATG-3’ and 5’-GCCATCGCAGAGACCAATCGA-3’

(c) 5’-GTATTTTAGACATATCGAAGT -3’ and 5’-AGCTAACCAGAGACGCTACCG-3’

Find the correct band pattern in gel lanes what size(s) of PCR products you would get if you used the following primers stated in parts (a), (b), and (c) to do a PCR reaction on the template DNA shown above.

TLS Online TPP Program

#Question id: 4738

#SCPH12 I Genetics

Red kernel color in wheat results from the presence of at least one dominant allele of each of two independently segregating genes . Kernels on rr bb plants are white, and the genotypes R— bb and rr B— result in brown kernel color. Suppose that plants of a variety that is true breeding for red kernels are crossed with plants true breeding for white kernels produced F1 were allowed to selfing .what are F2 phenotype ratio ?

TLS Online TPP Program

#Question id: 10576

#SCPH28 | Zoology

There is a species with following feature Low dispersion, late breeder, high investment in care for the young.Which of the following above feature showing growth pattern and survival ship curve?