Which of the following applies to AIDS patients?

TLS Online TPP Program

#Question id: 14118

#SCPH01 Biochemistry

Identify the file format given below:

>KX580312.1 Homo sapiens truncated breast cancer 1 (BRCA1) gene, exon 15 and partial cds

GTCATCCCCTTCTAAATGCCCATCATTAGATGATAGGTGGTACATGCACAGTTGCTCTGGGAGTCTTCAG

AATAGAAACTACCCATCTCAAGAGGAGCTCATTAAGGTTGTTGATGTGGAGGAGTAACAGCTGGAAGAGT

CTGGGCCACACGATTTGACGGAAACATCTTACTTGCCAAGGCAAGATCTAG

TLS Online TPP Program

#Question id: 2090

#I Life Science/ Life Sciences Group – I-V

Peripheral proteins bound to the exoplasmic face of the plasma membrane can also bind to:

TLS Online TPP Program

#Question id: 13097

#SCPH01 Biochemistry

You are a scientist who is using genomics to currently study a new bacterial species that no one has ever studied before. The following sequence is a piece of DNA within the coding region of a gene that you have recently sequenced.

 

If you take any bacterial gene sequence, before you begin doing any sequence analysis on it, there are six potential open reading frames. Why are there six?

TLS Online TPP Program

#Question id: 14109

#I Life Science/ Life Sciences Group – I-V

Which of the following are the application of bioinformatics?

TLS Online TPP Program

#Question id: 1586

#SCPH01 Biochemistry

In which of the cases would the precaution likely be taken to give the mother anti-Rh antibodies before delivering her baby?