Practice Questions

  1. Home
  2. Free Resources
  3. Practice Questions
  4. 49133
TLS Online TPP Program

#Question id: 8714

The reason that paralogous genes can diverge from each other within the same gene pool, whereas orthologous genes diverge only after gene pools are isolated from each other, is that ________.

#SCPH28 | Zoology
  1. having multiple copies of genes is essential for the occurrence of sympatric speciation in the wild
  2. paralogous genes can occur only in diploid species, thus they are absent from most prokaryotes
  3. polyploidy is a necessary precondition for the occurrence of sympatric speciation in the wild
  4. having an extra copy of a gene permits modifications to the copy without loss of the original gene product
More Questions
TLS Online TPP Program

#Question id: 15224

#SCPH05 I Biotechnology

Which technique can detect protease activity in sample
TLS Online TPP Program

#Question id: 4385

#SCPH28 | Zoology

The nuclear-receptor superfamily consists of several proteins that bind to consensus sequences of DNA response elements. Which of the following is NOT considered a member of this superfamily?
TLS Online TPP Program

#Question id: 2601

#SCPH28 | Zoology

Condition of basal level transcription (BLT);
TLS Online TPP Program

#Question id: 13101

#SCPH06 I Botany

You are a scientist who is using genomics to currently study a new bacterial species that no one has ever studied before. The following sequence is a piece of DNA within the coding region of a gene that you have recently sequenced.
 
You are using shotgun sequencing to determine the DNA sequence of the genome of this new bacterial species. For one strand of a 30-nucleotide long stretch of DNA, you get the following sequences out of your shotgun sequencing reaction. Assemble the entire 30-nt-long DNA sequence
 
5’-TGGGAGTTCCTCAAACGCGTTGTCACTGAC-3’
You put the DNA sequence that you have assembled into a computer program that tells you that the following piece of DNA, which comes from another bacterium, is a close match to the sequence you have sequenced from your bacterium: 5’-…TGGGCATTTCTCAAGCGGGTTGTAATGGAT…-3’
This 30-nt-long sequence fragment lies in the center of a gene, and that portion of the sequence encodes for this 10-amino acid-long part of a protein:
N-…Trp-Ala-Phe-Leu-Lys-Arg-Val-Val-Met-Asp…-C
You hypothesize that the sequence you have discovered is another bacterial species’ version of the same gene as this previously known gene. To measure how identical the two genes are at the DNA level and/or the two proteins are at the amino acid level, you can calculate a percentage of “identity” for each. This is the percent of nucleotides (for the gene) or the percent of amino acids (for the protein) that are identical between the two sequences.
What is the % identity between the two protein sequences?
TLS Online TPP Program

#Question id: 545

#SCPH28 | Zoology

Which one of the following is not among the six internationally accepted classes of enzymes?