A researcher is trying to construct a molecular-based phylogeny of the entire animal kingdom. Assuming that none of the following genes is absolutely conserved, which of the following would be the best choice on which to base the phylogeny?

TLS Online TPP Program

#Question id: 13088

#SCPH01 Biochemistry

To express a yeast gene in E. coli, your task is to design a strategy to insert the yeast gene into the bacterial plasmid. Below is a map of the area of the yeast genome surrounding the gene in which you are interested.

 

The distance between each tick mark placed on the line above is 100 bases in length

Below are the enzymes you can use, with their specific cut sites shown 5’-XXXXXX-3’ 3’-XXXXXX-5’

 

The plasmid is 5,000 bases long and the two farthest restriction enzyme sites are 200 bases apart. The plasmid has an ampicillin resistance gene somewhere on the plasmid distal from the restriction cut sites.

                              

You do the digestion of the insert and the vector and then ligate the two digestions together. You then transform the ligation into bacteria and select for ampicillin resistance. You get three colonies on your transformation plate. You isolate plasmid from each one and cut each plasmid with the enzyme XbaI. You then run your three digestions on an agarose gel and see the following patterns of bands. Describe what each plasmid actually was that was contained in each of the three colonies.

 

What is the Colony 1’s plasmid is;

TLS Online TPP Program

#Question id: 13095

#SCPH01 Biochemistry

You are practicing designing primers that you can use in PCR reactions. You want your primers to allow you to amplify the sequence found below.

 

 

 (a) 5’-ACTTCGATATGTCTAAAATAC-3’ and 5’- CGGTAGCGTCTCTGGTTAGCT -3’

(b) 5’-TGAAGCTATACAGATTTTATG-3’ and 5’-GCCATCGCAGAGACCAATCGA-3’

(c) 5’-GTATTTTAGACATATCGAAGT -3’ and 5’-AGCTAACCAGAGACGCTACCG-3’

Find the correct band pattern in gel lanes what size(s) of PCR products you would get if you used the following primers stated in parts (a), (b), and (c) to do a PCR reaction on the template DNA shown above.

TLS Online TPP Program

#Question id: 1649

#SCPH01 Biochemistry

Which of the following gene clusters do NOT contribute to antigen binding?

TLS Online TPP Program

#Question id: 27902

#Research Methodology

Research ethics committees are:

TLS Online TPP Program

#Question id: 592

#I Life Science/ Life Sciences Group – I-V

The expression: Vmax = k2[E]total applies to