Many crustaceans (for example, lobsters, shrimp, and crayfish) use their tails to swim, but crabs have reduced tails that curl under their shells and are not used in swimming. This is an example of ________.

TLS Online TPP Program

#Question id: 12712

#SCPH06 I Botany

ROS using respiratory burst oxidase homolog (RBOH) or NADPH  oxidase for Self- generation mechanism by some other processes , which are involved in ROS generation such as,

A) The amino-terminal cytoplasmic domain of RBOH proteins contains four serines (Ser) that can be phosphorylated by CDPKs and two EF hands that can bind calcium directly 

B) As ROS generation such as  H2O2,  by putting electron for oxidising  oxygen into the free radicals, these electron generation by oxidising NADPH and FADH2 in the cytosolic carboxy terminal of RBOH protein

C) The elevation of calcium and ROS levels during the early stages of the stress response activates protein kinases and phosphatases

D) ROS activated Ca2+ channel leads to Ca2+  influx from apoplastic space  to cytosol

Arrange the correct order of  following steps involve in ROS generation;

TLS Online TPP Program

#Question id: 3856

#SCPH06 I Botany

In eukaryotes, the conserved element closest to the transcription start site is called the:

TLS Online TPP Program

#Question id: 300

#SCPH28 | Zoology

Hydrogen bonding occurs in molecules when ___________________.

TLS Online TPP Program

#Question id: 13100

#SCPH05 I Biotechnology

 You are a scientist who is using genomics to currently study a new bacterial species that no one has ever studied before. The following sequence is a piece of DNA within the coding region of a gene that you have recently sequenced.

 

You are using shotgun sequencing to determine the DNA sequence of the genome of this new bacterial species. For one strand of a 30-nucleotide long stretch of DNA, you get the following sequences out of your shotgun sequencing reaction. Assemble the entire 30-nt-long DNA sequence

  

5’-TGGGAGTTCCTCAAACGCGTTGTCACTGAC-3’

You put the DNA sequence that you have assembled into a computer program that tells you that the following piece of DNA, which comes from another bacterium, is a close match to the sequence you have sequenced from your bacterium: 5’-…TGGGCATTTCTCAAGCGGGTTGTAATGGAT…-3’

This 30-nt-long sequence fragment lies in the center of a gene, and that portion of the sequence encodes for this 10-amino acid-long part of a protein: 

N-…Trp-Ala-Phe-Leu-Lys-Arg-Val-Val-Met-Asp…-C

You hypothesize that the sequence you have discovered is another bacterial species’ version of the same gene as this previously known gene. To measure how identical the two genes are at the DNA level and/or the two proteins are at the amino acid level, you can calculate a percentage of “identity” for each. This is the percent of nucleotides (for the gene) or the percent of amino acids (for the protein) that are identical between the two sequences.

What is the % identity between the two DNA sequences?

TLS Online TPP Program

#Question id: 8864

#SCPH28 | Zoology

Corals are most closely related to which group?