Practice Questions

  1. Home
  2. Free Resources
  3. Practice Questions
  4. 50091
TLS Online TPP Program

#Question id: 19303

A typical plant gene has the following regions 
(i) Promoter
(ii) enhancer/silencer
(iii) Cap site 
(iv) Translated region  
(v) Initiation codon
(vi) Exons 
(vii) intron
(viii) Stop codon
(ix) Poly (A) tail
Which of the following option is incorrect?

#SCPH28 | Zoology
  1. (i), (ii), (iii) & (iv)
  2. (i), (ii), (iii), (v)& (vi)
  3. (i), (ii), (iii), (v), (vi) & (vii)
  4. (i), (ii), (iii), (v), (vi), (vii), (viii) & (ix)
More Questions
TLS Online TPP Program

#Question id: 13101

#SCPH28 | Zoology

You are a scientist who is using genomics to currently study a new bacterial species that no one has ever studied before. The following sequence is a piece of DNA within the coding region of a gene that you have recently sequenced.
 
You are using shotgun sequencing to determine the DNA sequence of the genome of this new bacterial species. For one strand of a 30-nucleotide long stretch of DNA, you get the following sequences out of your shotgun sequencing reaction. Assemble the entire 30-nt-long DNA sequence
 
5’-TGGGAGTTCCTCAAACGCGTTGTCACTGAC-3’
You put the DNA sequence that you have assembled into a computer program that tells you that the following piece of DNA, which comes from another bacterium, is a close match to the sequence you have sequenced from your bacterium: 5’-…TGGGCATTTCTCAAGCGGGTTGTAATGGAT…-3’
This 30-nt-long sequence fragment lies in the center of a gene, and that portion of the sequence encodes for this 10-amino acid-long part of a protein:
N-…Trp-Ala-Phe-Leu-Lys-Arg-Val-Val-Met-Asp…-C
You hypothesize that the sequence you have discovered is another bacterial species’ version of the same gene as this previously known gene. To measure how identical the two genes are at the DNA level and/or the two proteins are at the amino acid level, you can calculate a percentage of “identity” for each. This is the percent of nucleotides (for the gene) or the percent of amino acids (for the protein) that are identical between the two sequences.
What is the % identity between the two protein sequences?
TLS Online TPP Program

#Question id: 1035

#SCPH06 I Botany

A new drug is developed that inhibits formation of the flagellar filament by impairing production of the protein flagellin. Is this going to be a good drug?
TLS Online TPP Program

#Question id: 3005

#I Life Science/ Life Sciences Group – I-V

Which of the following statement are incorrect?
TLS Online TPP Program

#Question id: 7309

#SCPH01 Biochemistry

Following statements are regarding to the molecular basis of the coincidence model in Arabidopsis.

A. In Arabidopsis under short days, there is little overlap between CO mRNA expression and daylight.

B. CO protein does not accumulate to sufficient levels in the phloem to promote the expression of the transmissible floral stimulus and the plant remains vegetative.

C. Under long days, the peak of CO mRNA abundance (at hours 12 through 16) overlaps with daylight (sensed by phyA and cryptochrome [cry]), allowing CO protein to accumulate.

D. CO activates FLC mRNA expression in the phloem, which causes flowering when the FT protein is translocated to the apical meristem.

Which of the following is incorrect?
TLS Online TPP Program

#Question id: 15998

#SCPH05 I Biotechnology

For culturing, plasma from the adult chicken is preferred to mammalian plasma because