Choose the correct order for the cloning process.

1. The production of cDNA is carried out using an enzyme termed Reverse transcriptase.

2. mRNA cannot be used directly in cloning.

3. It is possible to synthesis complementary DNA molecule to all the mRNA from the selected tissue.

4. The cDNA may be inserted into vectors and then cloned.

TLS Online TPP Program

#Question id: 10507

#SCPH06 I Botany

Rhizobacteria function as

 a) Nitrogen fixation

 b) depositing pathogens directly into the vascular system,

 c) producing antibiotics and antifungal agents for inhibiting soil pathogens

 d) herbivore sensors by sending electrical or chemical signals to surrounding cells

 Which one of the following combination is correct?

TLS Online TPP Program

#Question id: 18882

#SCPH01 Biochemistry

The resolving power of a microscope is determined by-

TLS Online TPP Program

#Question id: 27169

#SCPH01 Biochemistry

Which of the option is not suitable for given alignment

TLS Online TPP Program

#Question id: 14118

#SCPH05 I Biotechnology

Identify the file format given below:

>KX580312.1 Homo sapiens truncated breast cancer 1 (BRCA1) gene, exon 15 and partial cds

GTCATCCCCTTCTAAATGCCCATCATTAGATGATAGGTGGTACATGCACAGTTGCTCTGGGAGTCTTCAG

AATAGAAACTACCCATCTCAAGAGGAGCTCATTAAGGTTGTTGATGTGGAGGAGTAACAGCTGGAAGAGT

CTGGGCCACACGATTTGACGGAAACATCTTACTTGCCAAGGCAAGATCTAG

TLS Online TPP Program

#Question id: 762

#SCPH01 Biochemistry

Regarding the sugar residues in nucleic acids, which, if any, of the following statements is incorrect?