TLS Online TPP Program

#Question id: 13054


Precision will be reduced, but yield will be increased
Optimisation of a PCR reaction is often a compromise between the competing demands for precision, efficiency and yield. Although the specific effects may vary, generally, increasing the annealing temperature will increase non-specific primer binding and reduce precision. Increasing the length of the elongation phase will reduce the proportion of incomplete newly-synthesised strands and therefore increase yield. In this case, the potential effect on efficiency is unclear. Increasing the elongation phase would increase the reaction time, but the time taken to ramp down to a lower annealing temperature would be reduced.
What would the expected effect be on a PCR reaction if the primers used were slightly shorter and more variable than the intended oligonucleotide sequences?

#SCPH28 | Zoology
  1. The PCR reaction would not commence
  2. The PCR reaction would end after one cycle
  3. The reaction would generate a single short PCR product
  4. The reaction would yield a mixture of non-specific products
More Questions
TLS Online TPP Program

#Question id: 14117

#I Life Science/ Life Sciences Group – I-V

Identify the character based method used for the construction of a phylogenetic tree. 
P. Maximum parsimony 
Q. Neighbor joining 
R. Maximum likelihood 
S. Bootstrapping

TLS Online TPP Program

#Question id: 14117

#SCPH05 I Biotechnology

Identify the character based method used for the construction of a phylogenetic tree. 
P. Maximum parsimony 
Q. Neighbor joining 
R. Maximum likelihood 
S. Bootstrapping

TLS Online TPP Program

#Question id: 14117

#SCPH05 I Biotechnology

Identify the character based method used for the construction of a phylogenetic tree. 
P. Maximum parsimony 
Q. Neighbor joining 
R. Maximum likelihood 
S. Bootstrapping

TLS Online TPP Program

#Question id: 14118

#SCPH01 Biochemistry

Identify the file format given below:
>KX580312.1 Homo sapiens truncated breast cancer 1 (BRCA1) gene, exon 15 and partial cds
GTCATCCCCTTCTAAATGCCCATCATTAGATGATAGGTGGTACATGCACAGTTGCTCTGGGAGTCTTCAG
AATAGAAACTACCCATCTCAAGAGGAGCTCATTAAGGTTGTTGATGTGGAGGAGTAACAGCTGGAAGAGT
CTGGGCCACACGATTTGACGGAAACATCTTACTTGCCAAGGCAAGATCTAG

TLS Online TPP Program

#Question id: 14118

#I Life Science/ Life Sciences Group – I-V

Identify the file format given below:
>KX580312.1 Homo sapiens truncated breast cancer 1 (BRCA1) gene, exon 15 and partial cds
GTCATCCCCTTCTAAATGCCCATCATTAGATGATAGGTGGTACATGCACAGTTGCTCTGGGAGTCTTCAG
AATAGAAACTACCCATCTCAAGAGGAGCTCATTAAGGTTGTTGATGTGGAGGAGTAACAGCTGGAAGAGT
CTGGGCCACACGATTTGACGGAAACATCTTACTTGCCAAGGCAAGATCTAG

TLS Online TPP Program

#Question id: 14118

#SCPH05 I Biotechnology

Identify the file format given below:
>KX580312.1 Homo sapiens truncated breast cancer 1 (BRCA1) gene, exon 15 and partial cds
GTCATCCCCTTCTAAATGCCCATCATTAGATGATAGGTGGTACATGCACAGTTGCTCTGGGAGTCTTCAG
AATAGAAACTACCCATCTCAAGAGGAGCTCATTAAGGTTGTTGATGTGGAGGAGTAACAGCTGGAAGAGT
CTGGGCCACACGATTTGACGGAAACATCTTACTTGCCAAGGCAAGATCTAG