Precision will be reduced, but yield will be increased

Optimisation of a PCR reaction is often a compromise between the competing demands for precision, efficiency and yield. Although the specific effects may vary, generally, increasing the annealing temperature will increase non-specific primer binding and reduce precision. Increasing the length of the elongation phase will reduce the proportion of incomplete newly-synthesised strands and therefore increase yield. In this case, the potential effect on efficiency is unclear. Increasing the elongation phase would increase the reaction time, but the time taken to ramp down to a lower annealing temperature would be reduced.

Which of the following true about real time PCR?

TLS Online TPP Program

#Question id: 13100

#SCPH01 Biochemistry

 You are a scientist who is using genomics to currently study a new bacterial species that no one has ever studied before. The following sequence is a piece of DNA within the coding region of a gene that you have recently sequenced.

 

You are using shotgun sequencing to determine the DNA sequence of the genome of this new bacterial species. For one strand of a 30-nucleotide long stretch of DNA, you get the following sequences out of your shotgun sequencing reaction. Assemble the entire 30-nt-long DNA sequence

  

5’-TGGGAGTTCCTCAAACGCGTTGTCACTGAC-3’

You put the DNA sequence that you have assembled into a computer program that tells you that the following piece of DNA, which comes from another bacterium, is a close match to the sequence you have sequenced from your bacterium: 5’-…TGGGCATTTCTCAAGCGGGTTGTAATGGAT…-3’

This 30-nt-long sequence fragment lies in the center of a gene, and that portion of the sequence encodes for this 10-amino acid-long part of a protein: 

N-…Trp-Ala-Phe-Leu-Lys-Arg-Val-Val-Met-Asp…-C

You hypothesize that the sequence you have discovered is another bacterial species’ version of the same gene as this previously known gene. To measure how identical the two genes are at the DNA level and/or the two proteins are at the amino acid level, you can calculate a percentage of “identity” for each. This is the percent of nucleotides (for the gene) or the percent of amino acids (for the protein) that are identical between the two sequences.

What is the % identity between the two DNA sequences?

TLS Online TPP Program

#Question id: 572

#SCPH01 Biochemistry

Which of the following has not been shown to play a role in determining the specificity of protein kinases?

TLS Online TPP Program

#Question id: 10554

#SCPH06 I Botany

Transpiration is an important means of dissipating the heat input from sunlight, Heat dissipates because the water molecules that escape into the atmosphere

TLS Online TPP Program

#Question id: 27774

#Research Methodology

________ is related to some abstract ideas or theory.

TLS Online TPP Program

#Question id: 18072

#SCPH06 I Botany

First invertebrates insects fossil appeared in which of the following geological ages?

a) Mesozoic b) Jurassic

c) Paleozoic d) Devonian

e) Permian f) Pennsylvanian

Which of the following combinations give the best answer?