At high salt concentrations, the mRNA containing poly(A) tails binds to the complementary oligo(dT) molecules of the affinity column, and so, mRNA will be retained; all other RNA molecules can be washed through the column by further high salt solution. finally, the bound mRNA can be eluted by using

TLS Online TPP Program

#Question id: 573

#SCPH05 I Biotechnology

How is trypsinogen converted to trypsin?

TLS Online TPP Program

#Question id: 2287

#SCPH01 Biochemistry

Which characteristic do eukaryotic and prokaryotic flagella have in common?

TLS Online TPP Program

#Question id: 14118

#SCPH05 I Biotechnology

Identify the file format given below:

>KX580312.1 Homo sapiens truncated breast cancer 1 (BRCA1) gene, exon 15 and partial cds

GTCATCCCCTTCTAAATGCCCATCATTAGATGATAGGTGGTACATGCACAGTTGCTCTGGGAGTCTTCAG

AATAGAAACTACCCATCTCAAGAGGAGCTCATTAAGGTTGTTGATGTGGAGGAGTAACAGCTGGAAGAGT

CTGGGCCACACGATTTGACGGAAACATCTTACTTGCCAAGGCAAGATCTAG

TLS Online TPP Program

#Question id: 24444

#SCPH06 I Botany

What is the His bundle electrogram (HBE)?

TLS Online TPP Program

#Question id: 27996

#Research Methodology

Most ex post facto research projects are used for descriptive studies in which the researcher seeks to measure item such as_____

a) Frequency of shopping

b) Preferences of people or similar data

c) manipulate variables

d) any form of manipulation