TLS Online TPP Program
More Questions
TLS Online TPP Program
#Question id: 16012
#SCPH05 I Biotechnology
Which of the followings are the metabolic products of glucose and glutamine?
TLS Online TPP Program
#Question id: 19216
#SCPH28 | Zoology
Agrobacterium respond to which plant phenolic compounds which are excreted by susceptible wounded plants.
1. Toluene
2. Acetosyringone
3. Hydroxyacetosyringon
Which of the option have incorrect statement?
TLS Online TPP Program
#Question id: 8925
#SCPH05 I Biotechnology
What is the probable sequence in which the following clades of animals originated, from earliest to most recent?
1. tetrapods
2. vertebrates
3. deuterostomes
4. amniotes
5. bilaterians
TLS Online TPP Program
#Question id: 14213
#SCPH05 I Biotechnology
Which phase has the condition of specific growth rate “μ = 0”?
TLS Online TPP Program
#Question id: 14118
#SCPH05 I Biotechnology
Identify the file format given below:
>KX580312.1 Homo sapiens truncated breast cancer 1 (BRCA1) gene, exon 15 and partial cds
GTCATCCCCTTCTAAATGCCCATCATTAGATGATAGGTGGTACATGCACAGTTGCTCTGGGAGTCTTCAG
AATAGAAACTACCCATCTCAAGAGGAGCTCATTAAGGTTGTTGATGTGGAGGAGTAACAGCTGGAAGAGT
CTGGGCCACACGATTTGACGGAAACATCTTACTTGCCAAGGCAAGATCTAG