Glyphosate is extensively and rapidly metabolised by glyphosate oxidoreductase (gox), which breaksdown glyphosate into 

TLS Online TPP Program

#Question id: 13101

#SCPH05 I Biotechnology

You are a scientist who is using genomics to currently study a new bacterial species that no one has ever studied before. The following sequence is a piece of DNA within the coding region of a gene that you have recently sequenced.

 

You are using shotgun sequencing to determine the DNA sequence of the genome of this new bacterial species. For one strand of a 30-nucleotide long stretch of DNA, you get the following sequences out of your shotgun sequencing reaction. Assemble the entire 30-nt-long DNA sequence

 

5’-TGGGAGTTCCTCAAACGCGTTGTCACTGAC-3’

You put the DNA sequence that you have assembled into a computer program that tells you that the following piece of DNA, which comes from another bacterium, is a close match to the sequence you have sequenced from your bacterium: 5’-…TGGGCATTTCTCAAGCGGGTTGTAATGGAT…-3’

This 30-nt-long sequence fragment lies in the center of a gene, and that portion of the sequence encodes for this 10-amino acid-long part of a protein:

N-…Trp-Ala-Phe-Leu-Lys-Arg-Val-Val-Met-Asp…-C

You hypothesize that the sequence you have discovered is another bacterial species’ version of the same gene as this previously known gene. To measure how identical the two genes are at the DNA level and/or the two proteins are at the amino acid level, you can calculate a percentage of “identity” for each. This is the percent of nucleotides (for the gene) or the percent of amino acids (for the protein) that are identical between the two sequences.

What is the % identity between the two protein sequences?

TLS Online TPP Program

#Question id: 2922

#SCPH28 | Zoology

Human genes/proteins that regulate the cell cycle are most easily isolated by:

TLS Online TPP Program

#Question id: 28008

#Research Methodology

Which one is called non-probability sampling?

TLS Online TPP Program

#Question id: 4822

#SCPH28 | Zoology

In a particular species of mammal black hair (B) is dominant to green hair (b) and red eyes (R) are dominant to white eyes (r). If a BbRr individual is mated with a bbrrindividual the expected phenotypic ratio of the offspring is 1 black-red : 1 black-white: 1 green-red : 1 green-white. However, when you mate these individuals you find that the phenotypic ratio of the offspring is 6 black-red :1 black-white : 1 green-red : 6 green-white. What could account for this difference?

TLS Online TPP Program

#Question id: 2292

#SCPH05 I Biotechnology

which one is not function of Golgi apparatus,