Biological component interacts specifically to the analyte, which produces a physical change in reaction such as

1. Heat released or absorbed 

2. Production of electrical potential  

3. Movement of electrons 

Which of the following above statements are correct?

TLS Online TPP Program

#Question id: 16327

#SCPH28 | Zoology

Which of the following hormones release in response to stress?

TLS Online TPP Program

#Question id: 5429

#SCPH28 | Zoology

Assume that three loci, each with two alleles (A and a, B and b, C and c), determine the differences in height between two homozygous strains of a plant. These genes are additive and equal in their effects on plant height. One strain (aabbcc) is 10 cm in height. The other strain (AABBCC) is 22 cm in height. The two strains are crossed, and the resulting F1 are interbred to produce 1000 F2 progeny. what is number of F2 progeny having intermediate height?

TLS Online TPP Program

#Question id: 10285

#SCPH05 I Biotechnology

Some of the statements given shows the activity of PFK-1 and PFK-2, which of the following statements incorrectly shown these enzyme activity?

TLS Online TPP Program

#Question id: 13100

#SCPH01 Biochemistry

 You are a scientist who is using genomics to currently study a new bacterial species that no one has ever studied before. The following sequence is a piece of DNA within the coding region of a gene that you have recently sequenced.

 

You are using shotgun sequencing to determine the DNA sequence of the genome of this new bacterial species. For one strand of a 30-nucleotide long stretch of DNA, you get the following sequences out of your shotgun sequencing reaction. Assemble the entire 30-nt-long DNA sequence

  

5’-TGGGAGTTCCTCAAACGCGTTGTCACTGAC-3’

You put the DNA sequence that you have assembled into a computer program that tells you that the following piece of DNA, which comes from another bacterium, is a close match to the sequence you have sequenced from your bacterium: 5’-…TGGGCATTTCTCAAGCGGGTTGTAATGGAT…-3’

This 30-nt-long sequence fragment lies in the center of a gene, and that portion of the sequence encodes for this 10-amino acid-long part of a protein: 

N-…Trp-Ala-Phe-Leu-Lys-Arg-Val-Val-Met-Asp…-C

You hypothesize that the sequence you have discovered is another bacterial species’ version of the same gene as this previously known gene. To measure how identical the two genes are at the DNA level and/or the two proteins are at the amino acid level, you can calculate a percentage of “identity” for each. This is the percent of nucleotides (for the gene) or the percent of amino acids (for the protein) that are identical between the two sequences.

What is the % identity between the two DNA sequences?

TLS Online TPP Program

#Question id: 2116

#SCPH06 I Botany

When a cell is in equilibrium with its environment, which of the following processes occurs for substances that can diffuse through the plasma membrane?