An alternative method labeling strategy used in karyotyping and gene localisation is _______

TLS Online TPP Program

#Question id: 13095

#SCPH28 | Zoology

You are practicing designing primers that you can use in PCR reactions. You want your primers to allow you to amplify the sequence found below.

 

 

 (a) 5’-ACTTCGATATGTCTAAAATAC-3’ and 5’- CGGTAGCGTCTCTGGTTAGCT -3’

(b) 5’-TGAAGCTATACAGATTTTATG-3’ and 5’-GCCATCGCAGAGACCAATCGA-3’

(c) 5’-GTATTTTAGACATATCGAAGT -3’ and 5’-AGCTAACCAGAGACGCTACCG-3’

Find the correct band pattern in gel lanes what size(s) of PCR products you would get if you used the following primers stated in parts (a), (b), and (c) to do a PCR reaction on the template DNA shown above.

TLS Online TPP Program

#Question id: 18007

#SCPH06 I Botany

The following geological eras mark the advent of important events in the history of earth- origin of first vertebrates armored fishes, origin of First reptiles, origin of first dinosaurs;

a) Triassic b) Pennsylvanian

c) Ordovician d) Cambrian

Identify the correct match of the events with the geological era;

TLS Online TPP Program

#Question id: 13081

#SCPH28 | Zoology

Correct statements about RAPD’s

A. RAPD polymorphism is detected by using oligonucleotides usually more than 10 bases long of random sequences as primers in a reaction.

B. In a strain which has in genomic DNA sequences complementary to the primer oligonucleotide, PCR products will be detected in the gel,

C. Typical RAPD markers show limited variation between parents, especially in naturally inbreeding species.

D. RAPDs are more sensitive than RFLPs to experimental conditions making them more difficult to be consistent and reproducible.

TLS Online TPP Program

#Question id: 17077

#SCPH01 Biochemistry

Cells lacking Thymidine kinase if introduced into HAT medium which pathways will continue for nucleotide synthesis

TLS Online TPP Program

#Question id: 16132

#SCPH06 I Botany

You are running a human assisted reproduction clinic and providing state-of-the-art genetic diagnostic services. A married couple who already had a child with cystic fibrosis approach you because they wish to have another child, but only if they can be assured that the child will not have cystic fibrosis. You genotype the woman and discover that she is a heterozygote for Del508, the most common mutation causing cystic fibrosis. You suggest that the couple consider first polar body testing, in which several unfertilized oocytes (each with its first polar body) are retrieved from the woman, the first polar bodies are removed, and PCR tests are conducted on DNA from each of the first polar bodies. The couple agrees, and you obtain the following results:

 

the observation that the polar bodies for oocytes #1 and #5 test positive for both Del508 and the wild type sequence, because