You are a scientist who is using genomics to currently study a new bacterial species that no one has ever studied before. The following sequence is a piece of DNA within the coding region of a gene that you have recently sequenced.

 

You are using shotgun sequencing to determine the DNA sequence of the genome of this new bacterial species. For one strand of a 30-nucleotide long stretch of DNA, you get the following sequences out of your shotgun sequencing reaction. Assemble the entire 30-nt-long DNA sequence

 

5’-TGGGAGTTCCTCAAACGCGTTGTCACTGAC-3’

You put the DNA sequence that you have assembled into a computer program that tells you that the following piece of DNA, which comes from another bacterium, is a close match to the sequence you have sequenced from your bacterium: 5’-…TGGGCATTTCTCAAGCGGGTTGTAATGGAT…-3’

This 30-nt-long sequence fragment lies in the center of a gene, and that portion of the sequence encodes for this 10-amino acid-long part of a protein:

N-…Trp-Ala-Phe-Leu-Lys-Arg-Val-Val-Met-Asp…-C

You hypothesize that the sequence you have discovered is another bacterial species’ version of the same gene as this previously known gene. To measure how identical the two genes are at the DNA level and/or the two proteins are at the amino acid level, you can calculate a percentage of “identity” for each. This is the percent of nucleotides (for the gene) or the percent of amino acids (for the protein) that are identical between the two sequences.

What is the % identity between the two protein sequences?

#Question id: 3272

#SCPH28 | Zoology

Calculate the frequencies of the XO and X+ alleles respectively for this population.

#Question id: 3273

#SCPH06 I Botany

The number of forward mutations is equal to the number of reverse mutations then

a) Population is in equilibrium for forward and reverse mutation rates

b) The population is being in Hardy–Weinberg equilibrium

c) No further change in allelic frequency

#Question id: 3273

#SCPH28 | Zoology

The number of forward mutations is equal to the number of reverse mutations then

a) Population is in equilibrium for forward and reverse mutation rates

b) The population is being in Hardy–Weinberg equilibrium

c) No further change in allelic frequency

#Question id: 3274

#SCPH06 I Botany

The common edible frog of Europe is a hybrid between two species, Rana lessonae and Rana ridibunda. The hybrids were first described in 1758 and have a wide distribution, from France across central Europe to Russia. Both male and female hybrids exist, but when they mate among themselves, they are rarely successful in producing offspring. What can you infer from this information?

#Question id: 3274

#SCPH28 | Zoology

The common edible frog of Europe is a hybrid between two species, Rana lessonae and Rana ridibunda. The hybrids were first described in 1758 and have a wide distribution, from France across central Europe to Russia. Both male and female hybrids exist, but when they mate among themselves, they are rarely successful in producing offspring. What can you infer from this information?

#Question id: 3275

#SCPH06 I Botany

When imbalances occur in the sex ratio of sexual species that have two sexes (that is, other than a 50:50 ratio), the members of the minority sex often receive a greater proportion of care and resources from parents than do the offspring of the majority sex. This is most clearly an example of ________.