Scatchard plots are based on repeated equilibrium dialyses with a constant concentration of antibody and varying concentration of ligand. Which plots correctly verify the Scatchard equation that determined by equilibrium dialysis?

TLS Online TPP Program

#Question id: 5558

#SCPH06 I Botany

Fertilization of an egg without activation is most like ________.

TLS Online TPP Program

#Question id: 15237

#SCPH28 | Zoology

Agarose gels are used for the electrophoresis of

A. Proteins

B. DNA

C. RNA

D. Amino acids

TLS Online TPP Program

#Question id: 7021

#SCPH01 Biochemistry

The tracheal (respiratory) system in Drosophila embryos develops from epithelial sacs. The approximately 80 cells in each of these sacs become reorganized into primary, secondary, and tertiary branches without any cell division or cell death. This reorganization is initiated when nearby cells secrete a protein called Branchless, which acts as a:

TLS Online TPP Program

#Question id: 6958

#SCPH06 I Botany

Vg-1 and wnt are used in both frogs and chicks to establish a body axis, although in chicks this is the antero-posterior axis instead of the dorso-ventral axis. What is the region of the chick embryo that is thus analogous to the Nieuwkoop center?

TLS Online TPP Program

#Question id: 13100

#SCPH28 | Zoology

 You are a scientist who is using genomics to currently study a new bacterial species that no one has ever studied before. The following sequence is a piece of DNA within the coding region of a gene that you have recently sequenced.

 

You are using shotgun sequencing to determine the DNA sequence of the genome of this new bacterial species. For one strand of a 30-nucleotide long stretch of DNA, you get the following sequences out of your shotgun sequencing reaction. Assemble the entire 30-nt-long DNA sequence

  

5’-TGGGAGTTCCTCAAACGCGTTGTCACTGAC-3’

You put the DNA sequence that you have assembled into a computer program that tells you that the following piece of DNA, which comes from another bacterium, is a close match to the sequence you have sequenced from your bacterium: 5’-…TGGGCATTTCTCAAGCGGGTTGTAATGGAT…-3’

This 30-nt-long sequence fragment lies in the center of a gene, and that portion of the sequence encodes for this 10-amino acid-long part of a protein: 

N-…Trp-Ala-Phe-Leu-Lys-Arg-Val-Val-Met-Asp…-C

You hypothesize that the sequence you have discovered is another bacterial species’ version of the same gene as this previously known gene. To measure how identical the two genes are at the DNA level and/or the two proteins are at the amino acid level, you can calculate a percentage of “identity” for each. This is the percent of nucleotides (for the gene) or the percent of amino acids (for the protein) that are identical between the two sequences.

What is the % identity between the two DNA sequences?