TLS Online TPP Program
More Questions
TLS Online TPP Program
#Question id: 10760
#SCPH05 I Biotechnology
Following are some statements of secondary metabolites of terpenes in plants is incorrect?
TLS Online TPP Program
#Question id: 13101
#SCPH05 I Biotechnology
You are a scientist who is using genomics to currently study a new bacterial species that no one has ever studied before. The following sequence is a piece of DNA within the coding region of a gene that you have recently sequenced.
You are using shotgun sequencing to determine the DNA sequence of the genome of this new bacterial species. For one strand of a 30-nucleotide long stretch of DNA, you get the following sequences out of your shotgun sequencing reaction. Assemble the entire 30-nt-long DNA sequence
5’-TGGGAGTTCCTCAAACGCGTTGTCACTGAC-3’
You put the DNA sequence that you have assembled into a computer program that tells you that the following piece of DNA, which comes from another bacterium, is a close match to the sequence you have sequenced from your bacterium: 5’-…TGGGCATTTCTCAAGCGGGTTGTAATGGAT…-3’
This 30-nt-long sequence fragment lies in the center of a gene, and that portion of the sequence encodes for this 10-amino acid-long part of a protein:
N-…Trp-Ala-Phe-Leu-Lys-Arg-Val-Val-Met-Asp…-C
You hypothesize that the sequence you have discovered is another bacterial species’ version of the same gene as this previously known gene. To measure how identical the two genes are at the DNA level and/or the two proteins are at the amino acid level, you can calculate a percentage of “identity” for each. This is the percent of nucleotides (for the gene) or the percent of amino acids (for the protein) that are identical between the two sequences.
What is the % identity between the two protein sequences?
TLS Online TPP Program
#Question id: 929
#SCPH05 I Biotechnology
During B oxidation of fatty acids, ___________ is produced in peroxisomes but not in mitochondria.
TLS Online TPP Program
#Question id: 27878
#Research Methodology
Random sampling is also called _____________.
TLS Online TPP Program
#Question id: 13093
#SCPH05 I Biotechnology
You are studying a specific gene in yeast, and you want to express that yeast gene in E. coli. Your task is to design a strategy to insert the yeast gene into the bacterial plasmid. Below is a map of the area of the yeast genome surrounding the gene in which you are interested.
The distance between each tick mark placed on the line above is 100 bases in length
Below are the enzymes you can use, with their specific cut sites shown 5’-XXXXXX-3’ 3’-XXXXXX-5’
The plasmid is 5,000 bases long and the two farthest restriction enzyme sites are 200 bases apart. The plasmid has an ampicillin resistance gene somewhere on the plasmid distal from the restriction cut sites.
You transform your ligation planned in which two restriction enzymes would you use to design a way to get the insert into the vector if you had to use two enzymes simultaneously, into bacteria and plate the bacteria on Petri plates containing ampicillin. (You actually transform six different ligation mixtures, which are described below, into six different populations of cells, and plate each transformation onto a different plate, because you want to do all of the correct controls.) The next day you come in to lab to look at how many colonies of bacteria are on each plate. You are really excited, because the number of colonies you see on each plate tells you that the entire procedure worked! Which of the three following patterns of number of colonies did you see in order to conclude that you had a successful transformation?
In this table, DV = digested vector. DYG = digested yeast genome.
