In the cell cycle: there are four main phases, G1, S, G2 and M phase. S phase is the :

TLS Online TPP Program

#Question id: 15878

#SCPH05 I Biotechnology

A vitamin which has been found to inhibit callus formation and improve growth and quality of shoots.

TLS Online TPP Program

#Question id: 5243

#SCPH06 I Botany

Auxotroph culture (His- and Lac-) culture of E. coli was mutagenised. On what media would one spread the mutagenised cells to select prototroph for both His+  and Lac+ cells?

TLS Online TPP Program

#Question id: 3032

#I Life Science/ Life Sciences Group – I-V

Which of these statements about prokaryotes is correct?

TLS Online TPP Program

#Question id: 339

#SCPH06 I Botany

The edges of each base pair are exposed in the major and minor grooves, creating a pattern of hydrogen-bond donors and acceptors and of hydrophobic groups (allowing for Vander Waals interactions) that identifies the base pair. The edge of an C : G base pair displays the following chemical groups in the following order in the major groove:

TLS Online TPP Program

#Question id: 14118

#SCPH05 I Biotechnology

Identify the file format given below:

>KX580312.1 Homo sapiens truncated breast cancer 1 (BRCA1) gene, exon 15 and partial cds

GTCATCCCCTTCTAAATGCCCATCATTAGATGATAGGTGGTACATGCACAGTTGCTCTGGGAGTCTTCAG

AATAGAAACTACCCATCTCAAGAGGAGCTCATTAAGGTTGTTGATGTGGAGGAGTAACAGCTGGAAGAGT

CTGGGCCACACGATTTGACGGAAACATCTTACTTGCCAAGGCAAGATCTAG