Interview includes _________. 

TLS Online TPP Program

#Question id: 4142

#SCPH06 I Botany

The large structure consisting of a mRNA molecule being translated by multiple copies of the macromolecular complexes that carry out protein synthesis is called a:

TLS Online TPP Program

#Question id: 4575

#I Life Science/ Life Sciences Group – I-V

Monkeys of South and Central America have prehensile tails, meaning that their tails can be used to grasp objects. The tails of African and Asian monkeys are not prehensile. Which discipline is most likely to provide an evolutionary explanation for how this difference in tails came about?

TLS Online TPP Program

#Question id: 92

#SCPH06 I Botany

Monosaccharide derivatives in which an amino group replaces one of the hydroxyl groups may have important roles in

TLS Online TPP Program

#Question id: 3294

#SCPH28 | Zoology

Which one of these processes describes bottleneck effect?

TLS Online TPP Program

#Question id: 13101

#SCPH01 Biochemistry

You are a scientist who is using genomics to currently study a new bacterial species that no one has ever studied before. The following sequence is a piece of DNA within the coding region of a gene that you have recently sequenced.

 

You are using shotgun sequencing to determine the DNA sequence of the genome of this new bacterial species. For one strand of a 30-nucleotide long stretch of DNA, you get the following sequences out of your shotgun sequencing reaction. Assemble the entire 30-nt-long DNA sequence

 

5’-TGGGAGTTCCTCAAACGCGTTGTCACTGAC-3’

You put the DNA sequence that you have assembled into a computer program that tells you that the following piece of DNA, which comes from another bacterium, is a close match to the sequence you have sequenced from your bacterium: 5’-…TGGGCATTTCTCAAGCGGGTTGTAATGGAT…-3’

This 30-nt-long sequence fragment lies in the center of a gene, and that portion of the sequence encodes for this 10-amino acid-long part of a protein:

N-…Trp-Ala-Phe-Leu-Lys-Arg-Val-Val-Met-Asp…-C

You hypothesize that the sequence you have discovered is another bacterial species’ version of the same gene as this previously known gene. To measure how identical the two genes are at the DNA level and/or the two proteins are at the amino acid level, you can calculate a percentage of “identity” for each. This is the percent of nucleotides (for the gene) or the percent of amino acids (for the protein) that are identical between the two sequences.

What is the % identity between the two protein sequences?