The PCR consists of three defined sets of times and temperatures, termed steps

a) Denaturation at 94°C, for 0.5 min

b) Primer annealing at 55°C for 1.5 min

c) Extension at 72°C for 1 min

d) only denaturation and extension

TLS Online TPP Program

#Question id: 1689

#I Life Science/ Life Sciences Group – I-V

The intermolecular forces that contribute to the interaction between antibody and antigen:

TLS Online TPP Program

#Question id: 22943

#I Life Science/ Life Sciences Group – I-V

FLOWERING D (FD) that is expressed in the meristem, belongs to which, transcription factor family?

TLS Online TPP Program

#Question id: 754

#SCPH05 I Biotechnology

If the twisting of the DNA is in the same direction as that of the double helix, that is the helix is twisted up before closure, this form of super coiling is known as;

TLS Online TPP Program

#Question id: 17277

#SCPH05 I Biotechnology

Non-linear relationship between shear stress and shear rate exists in

TLS Online TPP Program

#Question id: 14118

#SCPH05 I Biotechnology

Identify the file format given below:

>KX580312.1 Homo sapiens truncated breast cancer 1 (BRCA1) gene, exon 15 and partial cds

GTCATCCCCTTCTAAATGCCCATCATTAGATGATAGGTGGTACATGCACAGTTGCTCTGGGAGTCTTCAG

AATAGAAACTACCCATCTCAAGAGGAGCTCATTAAGGTTGTTGATGTGGAGGAGTAACAGCTGGAAGAGT

CTGGGCCACACGATTTGACGGAAACATCTTACTTGCCAAGGCAAGATCTAG