Identify the file format given below:

>KX580312.1 Homo sapiens truncated breast cancer 1 (BRCA1) gene, exon 15 and partial cds

GTCATCCCCTTCTAAATGCCCATCATTAGATGATAGGTGGTACATGCACAGTTGCTCTGGGAGTCTTCAG

AATAGAAACTACCCATCTCAAGAGGAGCTCATTAAGGTTGTTGATGTGGAGGAGTAACAGCTGGAAGAGT

CTGGGCCACACGATTTGACGGAAACATCTTACTTGCCAAGGCAAGATCTAG

TLS Online TPP Program

#Question id: 15654

#SCPH01 Biochemistry

You are studying a new strain of E. coli that can utilize the disaccharide melibiose very efficiently. You find that utilization depends on the enzyme melibiase, which is encoded by the gene Mel1. Mel1 is not expressed unless melibiose is present in the growth medium. Next you isolate a mutation, designated MelB–, which gives uninducible melibiase activity. Mapping experiments show that MelB– is linked to Mel1. Using an F' factor that carries the chromosomal region surrounding Mel1, you perform the following genetic tests:

                      

Describe the basic genetic properties of the MelB– mutation?

TLS Online TPP Program

#Question id: 611

#SCPH05 I Biotechnology

Which statement is false about the sequential theory of enzyme catalysis?

TLS Online TPP Program

#Question id: 1089

#SCPH06 I Botany

Which of the following statements describes a likely effect of a drug designed that inhibits the cellular response to testosterone?

TLS Online TPP Program

#Question id: 18605

#SCPH01 Biochemistry

Thermal modulation are used in PCR for the functions of

TLS Online TPP Program

#Question id: 577

#SCPH05 I Biotechnology

Most of the known enzymes are ________.