You have isolated two mutations in the Lac operon that cause constitutive expression of Lac genes. You designate these mutants Lac1– and Lac2–. Making use of an F' that carries the Lac operon with the LacY gene mutated, you construct strains that you test for both ß-galactosidase activity and Lac permease activity with results shown below.

     

Classify each mutation as dominant or recessive and as cis- or trans-acting, giving the experimental result that allows you to arrive at each conclusion. Finally, deduce what type of Lac mutation best fits the properties of Lac 1– and of Lac 2–.

TLS Online TPP Program

#Question id: 2335

#Unit 2. Cellular Organization

How might viruses play a role in curing cystic fibrosis?

TLS Online TPP Program

#Question id: 11614

#Unit 6. System Physiology – Plant

During the biosynthesis of GA many stages will be involved in this pathway, one of which is takes place in the plastids is GGPP is converted into the ent-kaurene via  two steps of pathway involving enzymes known as

TLS Online TPP Program

#Question id: 24484

#Unit 3. Fundamental Processes

Which of the following is not the  target for P-TEFb

TLS Online TPP Program

#Question id: 19356

#Unit 12. Applied Biology

Genes were transferred from eukaryotes, more particularly from human beings, into prokaryotes like E. coli this phase is considered as

TLS Online TPP Program

#Question id: 13100

#Unit 13. Methods in Biology

 You are a scientist who is using genomics to currently study a new bacterial species that no one has ever studied before. The following sequence is a piece of DNA within the coding region of a gene that you have recently sequenced.

 

You are using shotgun sequencing to determine the DNA sequence of the genome of this new bacterial species. For one strand of a 30-nucleotide long stretch of DNA, you get the following sequences out of your shotgun sequencing reaction. Assemble the entire 30-nt-long DNA sequence

  

5’-TGGGAGTTCCTCAAACGCGTTGTCACTGAC-3’

You put the DNA sequence that you have assembled into a computer program that tells you that the following piece of DNA, which comes from another bacterium, is a close match to the sequence you have sequenced from your bacterium: 5’-…TGGGCATTTCTCAAGCGGGTTGTAATGGAT…-3’

This 30-nt-long sequence fragment lies in the center of a gene, and that portion of the sequence encodes for this 10-amino acid-long part of a protein: 

N-…Trp-Ala-Phe-Leu-Lys-Arg-Val-Val-Met-Asp…-C

You hypothesize that the sequence you have discovered is another bacterial species’ version of the same gene as this previously known gene. To measure how identical the two genes are at the DNA level and/or the two proteins are at the amino acid level, you can calculate a percentage of “identity” for each. This is the percent of nucleotides (for the gene) or the percent of amino acids (for the protein) that are identical between the two sequences.

What is the % identity between the two DNA sequences?