TLS Online TPP Program

#Question id: 15653


You are studying a new strain of E. coli that can utilize the disaccharide melibiose very efficiently. You find that utilization depends on the enzyme melibiase, which is encoded by the gene Mel1. Mel1 is not expressed unless melibiose is present in the growth medium. You have isolated a mutation that causes constitutive melibiase activity, which you designate MelA–. P1 phage mapping experiments using a Tn5 insertion linked to Mel1 show that MelA– is not linked to Mel1. Moreover you find that when an amber suppressor is introduced into a MelA– mutant, normal melibiase regulation is restored. Classify the MelA– mutation on the basis of genetic properties,  make a proposal for the type of regulatory functions affected by the MelA– mutation?

#Unit 13. Methods in Biology
  1. MelA is likely a constitutive regulator of Mel1 expression.
  2. MelA is likely a positive regulator of Mel1 expression.
  3. MelA is likely a negative regulator of Mel1 expression.
  4. MelA is likely a repressive regulator of Mel1 expression.
More Questions
TLS Online TPP Program

#Question id: 7269

#Unit 5. Developmental Biology

Following statements are regarding to gastrulation in chick embryo.

A. During gastrulation, future mesodermal and endodermal cells migrate from the epiblast through the primitive streak into the interior of the blastoderm.

B. An aggregation of cells, known as Hensen’s node, forms at the posterior end of the streak.

C. As the streak extends, cells of the epiblast move toward the primitive streak, through it, and then outward again underneath the surface to give rise internally to the mesoderm and endoderm, the latter displacing a lower layer of cells called the endoblast.

D. Cells that remain in the epiblast form the endoderm.

Which of the following statements are correct?

TLS Online TPP Program

#Question id: 13101

#Unit 13. Methods in Biology

You are a scientist who is using genomics to currently study a new bacterial species that no one has ever studied before. The following sequence is a piece of DNA within the coding region of a gene that you have recently sequenced.
 
You are using shotgun sequencing to determine the DNA sequence of the genome of this new bacterial species. For one strand of a 30-nucleotide long stretch of DNA, you get the following sequences out of your shotgun sequencing reaction. Assemble the entire 30-nt-long DNA sequence
 
5’-TGGGAGTTCCTCAAACGCGTTGTCACTGAC-3’
You put the DNA sequence that you have assembled into a computer program that tells you that the following piece of DNA, which comes from another bacterium, is a close match to the sequence you have sequenced from your bacterium: 5’-…TGGGCATTTCTCAAGCGGGTTGTAATGGAT…-3’
This 30-nt-long sequence fragment lies in the center of a gene, and that portion of the sequence encodes for this 10-amino acid-long part of a protein:
N-…Trp-Ala-Phe-Leu-Lys-Arg-Val-Val-Met-Asp…-C
You hypothesize that the sequence you have discovered is another bacterial species’ version of the same gene as this previously known gene. To measure how identical the two genes are at the DNA level and/or the two proteins are at the amino acid level, you can calculate a percentage of “identity” for each. This is the percent of nucleotides (for the gene) or the percent of amino acids (for the protein) that are identical between the two sequences.
What is the % identity between the two protein sequences?

TLS Online TPP Program

#Question id: 560

#Unit 1. Molecules and their Interaction Relevant to Biology

Vmax for an enzyme-catalyzed reaction:

TLS Online TPP Program

#Question id: 33149

#Unit 2. Cellular Organization

Which of the following statement is not correct regarding PP2A-B55?

TLS Online TPP Program

#Question id: 10499

#Unit 6. System Physiology – Plant

Stomata from intact, attached leaves of Arabidopsis illuminated with blue, red, and green light in a growth chamber, increases and decreases their aperture in response to light.

 

Find the CORRECT statements from the above graph.

i) Stomatal aperture increases when the green light is turned off, and close when the green light is turned on again

ii) Stomata from the phototropin-less double mutant phot1/phot2 respond to blue light and open further when green light is turned off

iii) stomata from the zeaxanthin less mutant npq1 do not respond to blue light and least effect to opening of the stomata further when green light is turned off

iv) the npq1 mutant and phot1/phot2 double mutant response indicate that the green reversal of the blue-light response requires zeaxanthin but also phototropin