TLS Online TPP Program
More Questions
TLS Online TPP Program
#Question id: 4211
#Unit 3. Fundamental Processes
If the following eukaryotic mRNA were properly modified and sent to the cytoplasm, what size protein (in amino acids) would it encode?
5’UCAGGACCUUAUGGACCAUUGCUGGGACCUUUGAGUGCUGUACCAUAGUUAAAGAUAGCCAUC 3’
TLS Online TPP Program
#Question id: 2148
#Unit 2. Cellular Organization
The specificity of the potassium channel for K+ over Na+ is mainly the result of the:
TLS Online TPP Program
#Question id: 18834
#Unit 13. Methods in Biology
A researcher is trying to alter five successive base pairs in the middle of a PCR amplified DNA fragments. Which technique is the most recommended for performing such experiment?
TLS Online TPP Program
#Question id: 14831
#Unit 2. Cellular Organization
A spirochete is a member of the phylum Spirochaetota, which contains distinctive diderm gram-negative bacteria, most of which have long, helically coiled cells. Movement of spirochetes occurs by means of structures called
TLS Online TPP Program
#Question id: 5587
#Unit 5. Developmental Biology
Which gene on the Y chromosome transforms the bipotential gonad into a testis in mammals?