Classes of RNA transcribed by the three eukaryotic nuclear RNA Polymerase;

Polymerase	RNA Transcribed
A. RNA polymerase I	i) tRNAs, 5S rRNA, snRNA, U6, 7S RNA
B. RNA polymerase II	ii) Pre-rRNA 28S, 18SrRNA,  5.8SrRNAs
C. RNA polymerase III	iii) mRNA, snRNAs, siRNAs, miRNAs

 Match the following correct combination given above combinations;

TLS Online TPP Program

#Question id: 13101

#Unit 13. Methods in Biology

You are a scientist who is using genomics to currently study a new bacterial species that no one has ever studied before. The following sequence is a piece of DNA within the coding region of a gene that you have recently sequenced.

 

You are using shotgun sequencing to determine the DNA sequence of the genome of this new bacterial species. For one strand of a 30-nucleotide long stretch of DNA, you get the following sequences out of your shotgun sequencing reaction. Assemble the entire 30-nt-long DNA sequence

 

5’-TGGGAGTTCCTCAAACGCGTTGTCACTGAC-3’

You put the DNA sequence that you have assembled into a computer program that tells you that the following piece of DNA, which comes from another bacterium, is a close match to the sequence you have sequenced from your bacterium: 5’-…TGGGCATTTCTCAAGCGGGTTGTAATGGAT…-3’

This 30-nt-long sequence fragment lies in the center of a gene, and that portion of the sequence encodes for this 10-amino acid-long part of a protein:

N-…Trp-Ala-Phe-Leu-Lys-Arg-Val-Val-Met-Asp…-C

You hypothesize that the sequence you have discovered is another bacterial species’ version of the same gene as this previously known gene. To measure how identical the two genes are at the DNA level and/or the two proteins are at the amino acid level, you can calculate a percentage of “identity” for each. This is the percent of nucleotides (for the gene) or the percent of amino acids (for the protein) that are identical between the two sequences.

What is the % identity between the two protein sequences?

TLS Online TPP Program

#Question id: 28256

#Unit 5. Developmental Biology

 In the Sea urchin sperm and egg containing molecules are present in concentration differences manner, such as

TLS Online TPP Program

#Question id: 5360

#Unit 8. Inheritance Biology

Following some different genetic disorder traces in families. 

Family	Father	Mother	Son	Daughter
A	Affected	Affected	Unaffected	Unaffected
B	Affected	Affected	Unaffected	Affected
C	Unaffected	Unaffected	Undetermined	Affected
D	Affected	Unaffected	Unaffected	Affected

 Which of the following possible mode of inheritance in the Family A, B, C and D respectively

TLS Online TPP Program

#Question id: 28712

#Unit 2. Cellular Organization

COPII Vesicle transport from ER to cis Golgi network, these COPII vesicle coated with proteins_____?_____

TLS Online TPP Program

#Question id: 13084

#Unit 13. Methods in Biology

Statement: In a modified version of AFLP, the selection of fragments using biotin-streptavidin binding is avoided.

Explanations: I. The fragments are ligated to the appropriate adapters and used for PCR amplification using two AFLP primers, each primer having a single selection nucleotide; this is called preamplification step.

II. The PCR products from this preamplificated step are diluted and used as template for second PCR amplification.