Practice Questions

  1. Home
  2. Free Resources
  3. Practice Questions
  4. 4445
TLS Online TPP Program

#Question id: 4658

Members of two different species possess a similar-looking structure that they use in a similar fashion to perform the same function. Which information would best help distinguish between an explanation based on homology versus one based on convergent evolution?

#Unit 11. Evolution and Behavior

  1. The two species live at great distance from each other.

  2. The two species share many proteins in common, and the nucleotide sequences that code for these proteins are almost identical.

  3. The sizes of the structures in adult members of both species are similar in size.

  4. Both species are well adapted to their particular environments.

More Questions
TLS Online TPP Program

#Question id: 1382

#Unit 4. Cell Communication and Cell Signaling

Following statements are regarding to cell-cell and cell–extracellular matrix junctions and their adhesion molecules.

A. Adherens junctions and desmosomes are integrin-containing anchoring junctions that bind the membranes of adjacent cells, giving strength and rigidity to the entire tissue.

B. Hemidesmosomes are cadherin-containing anchoring junctions that attach cells to elements of the underlying extracellular matrix.

C. Integrins are a large family of αβ heterodimeric cell-surface proteins that mediate both cell-cell and cell-matrix adhesions and inside-out and outside-in signaling in numerous tissues.

D. Tight junctions block the diffusion of proteins and some lipids in the plane of the plasma membrane, contributing to the polarity of epithelial cells. They also limit and regulate the extracellular (paracellular) flow of water and solutes from one side of the epithelium to the other.

Which of the following statements are incorrect?
TLS Online TPP Program

#Question id: 14687

#Unit 13. Methods in Biology

Find the probability of drawing one rupee coin from a purse with two compartments one of which contains 3 fifty paisa coins and 2 one-rupee coins and the other contains 2 fifty paisa coins and 3 one rupee coins.
TLS Online TPP Program

#Question id: 286

#Unit 1. Molecules and their Interaction Relevant to Biology

________ catalyze the hydrolysis of phosphodiester linkages to release nucleotide residues from only one end of a polypeptide chain.
TLS Online TPP Program

#Question id: 13100

#Unit 13. Methods in Biology

 You are a scientist who is using genomics to currently study a new bacterial species that no one has ever studied before. The following sequence is a piece of DNA within the coding region of a gene that you have recently sequenced.
 
You are using shotgun sequencing to determine the DNA sequence of the genome of this new bacterial species. For one strand of a 30-nucleotide long stretch of DNA, you get the following sequences out of your shotgun sequencing reaction. Assemble the entire 30-nt-long DNA sequence
  
5’-TGGGAGTTCCTCAAACGCGTTGTCACTGAC-3’
You put the DNA sequence that you have assembled into a computer program that tells you that the following piece of DNA, which comes from another bacterium, is a close match to the sequence you have sequenced from your bacterium: 5’-…TGGGCATTTCTCAAGCGGGTTGTAATGGAT…-3’
This 30-nt-long sequence fragment lies in the center of a gene, and that portion of the sequence encodes for this 10-amino acid-long part of a protein: 
N-…Trp-Ala-Phe-Leu-Lys-Arg-Val-Val-Met-Asp…-C
You hypothesize that the sequence you have discovered is another bacterial species’ version of the same gene as this previously known gene. To measure how identical the two genes are at the DNA level and/or the two proteins are at the amino acid level, you can calculate a percentage of “identity” for each. This is the percent of nucleotides (for the gene) or the percent of amino acids (for the protein) that are identical between the two sequences.
What is the % identity between the two DNA sequences?
TLS Online TPP Program

#Question id: 995

#Unit 1. Molecules and their Interaction Relevant to Biology

Saturated fatty acids are degraded by the stepwise  reactions of B oxidation, producing acetyl-CoA. Under aerobic conditions, how many ATP molecules would be produced as a consequence of removal of each acetyl-CoA?