TLS Online TPP Program

#Question id: 11931


Sexual dimorphism may arise from: 

#Unit 10. Ecological Principles
  1. Gender differences in life histories and ecological relationships.
  2. Combat among males
  3. Direct effects of mate choice (usually done by females)
  4. All of the above
More Questions
TLS Online TPP Program

#Question id: 10601

#Unit 10. Ecological Principles

following some statement are given about Grime’s triangle that is alternative to r and K selection is correct?

A. Ruderals are adapted to take advantage of habitat disturbance, but these are less competitor 

B. Any species cannot be a good stress tolerator and a good competitor at the same time

C. Mangroves and lichens are good stress tolerant and also good adopted to disturbance

D. Many perennial herbs are good adapted to habitat disturbance, but these are less competitor 

Which one of the following options represents a combination of correct statements?

TLS Online TPP Program

#Question id: 4093

#Unit 3. Fundamental Processes

Which of the following processes is NOT an example of allosteric regulation? 

TLS Online TPP Program

#Question id: 5785

#Unit 8. Inheritance Biology

Which disease is the result of a somatic mutation?

TLS Online TPP Program

#Question id: 29497

#Unit 6. System Physiology – Plant

Which of the following is a constitutive transcriptional activators in the dark

TLS Online TPP Program

#Question id: 13095

#Unit 13. Methods in Biology

You are practicing designing primers that you can use in PCR reactions. You want your primers to allow you to amplify the sequence found below.
 

 
 (a) 5’-ACTTCGATATGTCTAAAATAC-3’ and 5’- CGGTAGCGTCTCTGGTTAGCT -3’
(b) 5’-TGAAGCTATACAGATTTTATG-3’ and 5’-GCCATCGCAGAGACCAATCGA-3’
(c) 5’-GTATTTTAGACATATCGAAGT -3’ and 5’-AGCTAACCAGAGACGCTACCG-3’
Find the correct band pattern in gel lanes what size(s) of PCR products you would get if you used the following primers stated in parts (a), (b), and (c) to do a PCR reaction on the template DNA shown above.