TLS Online TPP Program

#Question id: 901


Proteins with high Tm values are generally stable at

#Unit 1. Molecules and their Interaction Relevant to Biology
  1. room temperature (21 °C). 

  2. 50 ° to 60 °C.

  3. temperatures below 50 °C.

  4. temperatures above 60 °C.

More Questions
TLS Online TPP Program

#Question id: 15854

#Unit 5. Developmental Biology

In which drosophila developmental stage late promoter becomes active?

TLS Online TPP Program

#Question id: 2872

#Unit 2. Cellular Organization

Concerning disorders resulting from unstable expansion of tandem oligonucleotide repeats, which, if any of the following statements is false.

A) The expansions can occur in coding DNA in some cases, and in noncoding DNA in other cases.

B) The repeats are of a variable number of nucleotides (from three to six) in both coding DNA and noncoding DNA.

C) The expansions in noncoding DNA are generally much larger in size than those in coding DNA.

D) The expanded arrays in noncoding DNA always result in loss of function of the host gene or of a neighboring gene.

TLS Online TPP Program

#Question id: 13100

#Unit 13. Methods in Biology

 You are a scientist who is using genomics to currently study a new bacterial species that no one has ever studied before. The following sequence is a piece of DNA within the coding region of a gene that you have recently sequenced.
 
You are using shotgun sequencing to determine the DNA sequence of the genome of this new bacterial species. For one strand of a 30-nucleotide long stretch of DNA, you get the following sequences out of your shotgun sequencing reaction. Assemble the entire 30-nt-long DNA sequence
  
5’-TGGGAGTTCCTCAAACGCGTTGTCACTGAC-3’
You put the DNA sequence that you have assembled into a computer program that tells you that the following piece of DNA, which comes from another bacterium, is a close match to the sequence you have sequenced from your bacterium: 5’-…TGGGCATTTCTCAAGCGGGTTGTAATGGAT…-3’
This 30-nt-long sequence fragment lies in the center of a gene, and that portion of the sequence encodes for this 10-amino acid-long part of a protein: 
N-…Trp-Ala-Phe-Leu-Lys-Arg-Val-Val-Met-Asp…-C
You hypothesize that the sequence you have discovered is another bacterial species’ version of the same gene as this previously known gene. To measure how identical the two genes are at the DNA level and/or the two proteins are at the amino acid level, you can calculate a percentage of “identity” for each. This is the percent of nucleotides (for the gene) or the percent of amino acids (for the protein) that are identical between the two sequences.
What is the % identity between the two DNA sequences?

TLS Online TPP Program

#Question id: 11832

#Unit 6. System Physiology – Plant

Ethylene production and action can be inhibited by various types of inhibitors, some statements about  the inhibitor is given below, which one of the following is incorrect?

TLS Online TPP Program

#Question id: 341

#Unit 1. Molecules and their Interaction Relevant to Biology

 Which force can stabilize a DNA double-helix?