TLS Online TPP Program

#Question id: 12366


During nucleotide formation addition of purines and pyrimidines on sugar residue occurs at Nitrogen position no.

#Unit 1. Molecules and their Interaction Relevant to Biology
  1. N1 &N9 respectively
  2. N9 &N1 respectively
  3. N1 &N3 respectively
  4. N3 &N1 respectively
More Questions
TLS Online TPP Program

#Question id: 4137

#Unit 3. Fundamental Processes

Formation of the ribosomal initiation complex for bacterial protein synthesis does not require:

TLS Online TPP Program

#Question id: 5935

#General Aptitude

What is the minimum sum of the number of Saturday and Sundays in a leap year 

TLS Online TPP Program

#Question id: 10362

#Unit 6. System Physiology – Plant

Bacteria can convert atmospheric nitrogen into ammonia, Several form symbiotic associations with higher plants is given below;

               HOST PLANT                                                                          N-FIXING SYMBIONTS

A) Gunnera                                                                            i) Frankia

      B) Azolla                                                                                ii) Acetobacter

C) Leguminous                                                                     iii) Azospirillum

             D) Actinorhizal                                                                      iv) Nostoc

             E) Sugarcane                                                                         v) Anabaena

             F) Miscanthus                                                                       vi) Sinorhizobium


Which of the following combination with the host plants and n-fixing symbionts is CORRECT?

TLS Online TPP Program

#Question id: 28289

#Unit 5. Developmental Biology

 which of the following enzyme that cleaves the proteins linking the vitelline envelope to the cell membrane ?

TLS Online TPP Program

#Question id: 13095

#Unit 13. Methods in Biology

You are practicing designing primers that you can use in PCR reactions. You want your primers to allow you to amplify the sequence found below.
 

 
 (a) 5’-ACTTCGATATGTCTAAAATAC-3’ and 5’- CGGTAGCGTCTCTGGTTAGCT -3’
(b) 5’-TGAAGCTATACAGATTTTATG-3’ and 5’-GCCATCGCAGAGACCAATCGA-3’
(c) 5’-GTATTTTAGACATATCGAAGT -3’ and 5’-AGCTAACCAGAGACGCTACCG-3’
Find the correct band pattern in gel lanes what size(s) of PCR products you would get if you used the following primers stated in parts (a), (b), and (c) to do a PCR reaction on the template DNA shown above.