You are practicing designing primers that you can use in PCR reactions. You want your primers to allow you to amplify the sequence found below.

 

 

 (a) 5’-ACTTCGATATGTCTAAAATAC-3’ and 5’- CGGTAGCGTCTCTGGTTAGCT -3’

(b) 5’-TGAAGCTATACAGATTTTATG-3’ and 5’-GCCATCGCAGAGACCAATCGA-3’

(c) 5’-GTATTTTAGACATATCGAAGT -3’ and 5’-AGCTAACCAGAGACGCTACCG-3’

Find the correct band pattern in gel lanes what size(s) of PCR products you would get if you used the following primers stated in parts (a), (b), and (c) to do a PCR reaction on the template DNA shown above.

#Question id: 10292

#Unit 6. System Physiology – Plant

The oxidative pentose phosphate pathway also known as

#Question id: 10293

#Unit 6. System Physiology – Plant

the main glucose transporter in the cells of skeletal muscle, cardiac muscle, and adipose tissue, which is

#Question id: 10294

#Unit 6. System Physiology – Plant

Which of the following route are available for the oxidation of sugars in plant cells?

#Question id: 10295

#Unit 6. System Physiology – Plant

Reactions of the pentose phosphate pathway regeneration run six turns of this cycle, what will be predict after that?

#Question id: 10296

#Unit 6. System Physiology – Plant

Which of the following statements about the oxidative pentose phosphate pathway is incorrect?

#Question id: 10297

#Unit 6. System Physiology – Plant

The following statements are related to pentose phosphate pathway.

a) The first and third steps are oxidations with large, negative standard free-energy changes and are essentially irreversible in the cell

b) NADPH rises and inhibits the first enzyme in the pentose phosphate pathway. As a result, more glucose 6-phosphate is available for glycolysis

c) All the enzymes of the reversible reaction of the pentose phosphate pathway are located in the cytosol

d) The NADPH is used for biosynthetic reactions such as lipid synthesis and nitrogen assimilation in the cytosol

which one of the following combination  of above statements is incorrect?