You are practicing designing primers that you can use in PCR reactions. You want your primers to allow you to amplify the sequence found below.

 

 

 (a) 5’-ACTTCGATATGTCTAAAATAC-3’ and 5’- CGGTAGCGTCTCTGGTTAGCT -3’

(b) 5’-TGAAGCTATACAGATTTTATG-3’ and 5’-GCCATCGCAGAGACCAATCGA-3’

(c) 5’-GTATTTTAGACATATCGAAGT -3’ and 5’-AGCTAACCAGAGACGCTACCG-3’

Find the correct band pattern in gel lanes what size(s) of PCR products you would get if you used the following primers stated in parts (a), (b), and (c) to do a PCR reaction on the template DNA shown above.

#Question id: 176

#Unit 1. Molecules and their Interaction Relevant to Biology

A peptide has the sequence Glu–His–Trp–Ser–Gly–Leu–Arg–Pro–Gly. What is the net charge of the molecule at pH 3

#Question id: 176

#Unit 1. Molecules and their Interaction Relevant to Biology

A peptide has the sequence Glu–His–Trp–Ser–Gly–Leu–Arg–Pro–Gly. What is the net charge of the molecule at pH 3

#Question id: 177

#Unit 1. Molecules and their Interaction Relevant to Biology

The titration curve of alanine shows the ionization of two functional groups with pKa values of 2.34 and 9.69, corresponding to the ionization of the carboxyl and the protonated amino groups, respectively. The titration of di-, tri-, and larger oligopeptides of alanine also shows the ionization of only two functional groups, although the experimental pKa values are different. The trend in pKa values is summarized in the table. Which of the following is a reason for this shift in pK values

#Question id: 178

#Unit 1. Molecules and their Interaction Relevant to Biology

Given the pKa values of different acidic sites in cysteine, the principal ionic form which will never exist at any pH

#Question id: 179

#Unit 1. Molecules and their Interaction Relevant to Biology

The average molecular weight of the 20 standard amino acids is 138, but biochemists use 110 when estimating the number of amino acids in a protein of known molecular weight.  Why?

#Question id: 180

#Unit 1. Molecules and their Interaction Relevant to Biology

Which of the following statements about aromatic amino acids is correct?