TLS Online TPP Program

#Question id: 12758


Refer to the following experiment, which is designed to test the co evolutionary relationships among an unpalatable butterfly (the  monarch),  a  palatable  butterfly  (the  viceroy),  and  a  butterfly  predator  (the  jay).  Monarch butterflies are reared on three diets: milkweed (their natural food), cabbage, and cabbage treated with an extract from milkweed leaves. Viceroy butterflies, mimics of monarchs, also are reared on three diets: willows (their natural food), cabbage, and cabbage treated with an extract from milkweed leaves. In trial 1 of the first experiment, adult butterflies reared on a particular diet are presented one at a  time  at  1-hour  intervals  to  jays  and  the  jays  are  allowed  to  feed.  Each jay is  fed  until  it refuses to eat the butterfly presented, but no more than 12 butterflies are presented to a jay during a particular test. Five birds are used for each test; therefore, up to 60 butterflies can be consumed for each diet test. The observer records the actual number of butterflies  eaten. In trial 2, the experiment is repeated 2 weeks later. In the second experiment, the butterflies are reared on the same diets as in experiment 1. However, when they are offered to jays, some jays receive a monarch  reared  on  milkweed  before  being  offered  the  butterflies  reared  on  the  experimental  diets;  the  other  group  of jays is  first given a viceroy reared on willow before being  offered the butterflies reared on the experimental diets. The initial butterfly offered is included in the total number eaten, but no more than 12 butterflies are presented to each jay.

The experimental design and the data indicate which of the following about the jays? 

#Part-B Specialized Branches in Biotechnology
  1. Jays learn to avoid eating monarchs by expenence.
  2. Jays have a built-in instinct that enables them to recognize and avoid eating monarchs.
  3. Eating a single monarch causes a jay to avoid eating another monarch for an indefinite period. 
  4. A jay needs to eat many monarchs before it decides that monarchs are unpalatable.

More Questions
TLS Online TPP Program

#Question id: 14116

#Part-B Specialized Branches in Biotechnology

Which of the following statements are CORRECT when a protein sequence database is searched using the BLAST algorithm? 
P. A larger E-value indicates higher sequence similarity 
Q. E-value < 10^-10 indicates sequence homology 
R. A higher BLAST score indicates higher sequence similarity 
S. E-value > 10^10 indicates sequence homology 

TLS Online TPP Program

#Question id: 14116

#Part-A Aptitude & General Biotechnology

Which of the following statements are CORRECT when a protein sequence database is searched using the BLAST algorithm? 
P. A larger E-value indicates higher sequence similarity 
Q. E-value < 10^-10 indicates sequence homology 
R. A higher BLAST score indicates higher sequence similarity 
S. E-value > 10^10 indicates sequence homology 

TLS Online TPP Program

#Question id: 14117

#Part-B Specialized Branches in Biotechnology

Identify the character based method used for the construction of a phylogenetic tree. 
P. Maximum parsimony 
Q. Neighbor joining 
R. Maximum likelihood 
S. Bootstrapping

TLS Online TPP Program

#Question id: 14117

#Part-A Aptitude & General Biotechnology

Identify the character based method used for the construction of a phylogenetic tree. 
P. Maximum parsimony 
Q. Neighbor joining 
R. Maximum likelihood 
S. Bootstrapping

TLS Online TPP Program

#Question id: 14118

#Part-B Specialized Branches in Biotechnology

Identify the file format given below:
>KX580312.1 Homo sapiens truncated breast cancer 1 (BRCA1) gene, exon 15 and partial cds
GTCATCCCCTTCTAAATGCCCATCATTAGATGATAGGTGGTACATGCACAGTTGCTCTGGGAGTCTTCAG
AATAGAAACTACCCATCTCAAGAGGAGCTCATTAAGGTTGTTGATGTGGAGGAGTAACAGCTGGAAGAGT
CTGGGCCACACGATTTGACGGAAACATCTTACTTGCCAAGGCAAGATCTAG

TLS Online TPP Program

#Question id: 14118

#Part-A Aptitude & General Biotechnology

Identify the file format given below:
>KX580312.1 Homo sapiens truncated breast cancer 1 (BRCA1) gene, exon 15 and partial cds
GTCATCCCCTTCTAAATGCCCATCATTAGATGATAGGTGGTACATGCACAGTTGCTCTGGGAGTCTTCAG
AATAGAAACTACCCATCTCAAGAGGAGCTCATTAAGGTTGTTGATGTGGAGGAGTAACAGCTGGAAGAGT
CTGGGCCACACGATTTGACGGAAACATCTTACTTGCCAAGGCAAGATCTAG