TLS Online TPP Program
More Questions
TLS Online TPP Program
#Question id: 16775
#Part-A Aptitude & General Biotechnology
If the mean and the mode are given as 35 and 30. Find the Median.
TLS Online TPP Program
#Question id: 4382
#Part-A Aptitude & General Biotechnology
All of the following events play a role in yeast-mating type switching except
TLS Online TPP Program
#Question id: 14118
#Part-B Specialized Branches in Biotechnology
Identify the file format given below:
>KX580312.1 Homo sapiens truncated breast cancer 1 (BRCA1) gene, exon 15 and partial cds
GTCATCCCCTTCTAAATGCCCATCATTAGATGATAGGTGGTACATGCACAGTTGCTCTGGGAGTCTTCAG
AATAGAAACTACCCATCTCAAGAGGAGCTCATTAAGGTTGTTGATGTGGAGGAGTAACAGCTGGAAGAGT
CTGGGCCACACGATTTGACGGAAACATCTTACTTGCCAAGGCAAGATCTAG
TLS Online TPP Program
#Question id: 18800
#Part-A Aptitude & General Biotechnology
Propidium iodide-labeled cells can be identify cells within the populations are at each stage of the cell cycle. After passing through flow cytometer a graph is observed
In this double diploid cell are found at
TLS Online TPP Program
#Question id: 16484
#Part-B Specialized Branches in Biotechnology
One of the chief disadvantage of all plasma clot methods is that