TLS Online TPP Program
More Questions
TLS Online TPP Program
#Question id: 14118
#Part-A Aptitude & General Biotechnology
Identify the file format given below:
>KX580312.1 Homo sapiens truncated breast cancer 1 (BRCA1) gene, exon 15 and partial cds
GTCATCCCCTTCTAAATGCCCATCATTAGATGATAGGTGGTACATGCACAGTTGCTCTGGGAGTCTTCAG
AATAGAAACTACCCATCTCAAGAGGAGCTCATTAAGGTTGTTGATGTGGAGGAGTAACAGCTGGAAGAGT
CTGGGCCACACGATTTGACGGAAACATCTTACTTGCCAAGGCAAGATCTAG
TLS Online TPP Program
#Question id: 14119
#Part-B Specialized Branches in Biotechnology
Which of the following is incorrect regarding sequence homology?
TLS Online TPP Program
#Question id: 14119
#Part-A Aptitude & General Biotechnology
Which of the following is incorrect regarding sequence homology?
TLS Online TPP Program
#Question id: 14120
#Part-B Specialized Branches in Biotechnology
Which of the following is not a variant of BLAST?
TLS Online TPP Program
#Question id: 14120
#Part-A Aptitude & General Biotechnology
Which of the following is not a variant of BLAST?
TLS Online TPP Program
#Question id: 14121
#Part-B Specialized Branches in Biotechnology
Which of the following is not the classification of SCOP?
