Practice Questions

  1. Home
  2. Free Resources
  3. Practice Questions
  4. 24646
TLS Online TPP Program

#Question id: 14135

Which of the following statement is correct about PAM matrix? 

#Part-A Aptitude & General Biotechnology
  1. The PAM matrices were first constructed by Margaret Dayhoff
  2. PAM matrices with lower serial numbers are more suitable for aligning more closely related sequences.
  3. PAM stands for “point accepted mutation” 
  4. All of the above 
More Questions
TLS Online TPP Program

#Question id: 11934

#Part-B Specialized Branches in Biotechnology

Which of the following represents the basis for transduction of a sensory stimulus into nerve impulses?
TLS Online TPP Program

#Question id: 18832

#Part-A Aptitude & General Biotechnology

The following PCR technique allows measuring the DNA amplification at each cycle of PCR contrary to end point detection in traditional PCR
TLS Online TPP Program

#Question id: 14118

#Part-B Specialized Branches in Biotechnology

Identify the file format given below:
>KX580312.1 Homo sapiens truncated breast cancer 1 (BRCA1) gene, exon 15 and partial cds
GTCATCCCCTTCTAAATGCCCATCATTAGATGATAGGTGGTACATGCACAGTTGCTCTGGGAGTCTTCAG
AATAGAAACTACCCATCTCAAGAGGAGCTCATTAAGGTTGTTGATGTGGAGGAGTAACAGCTGGAAGAGT
CTGGGCCACACGATTTGACGGAAACATCTTACTTGCCAAGGCAAGATCTAG
TLS Online TPP Program

#Question id: 2603

#Part-A Aptitude & General Biotechnology

If no ribosome begins translation of the leader peptide AUG, the hairpin forms by pairing of sequences 1 and 2, preventing formation of the 2 –3 hairpin, and allowing formation of the hairpin at sequences 3 –4, the condition is
TLS Online TPP Program

#Question id: 19880

#Part-A Aptitude & General Biotechnology

Restriction enzymes are also called as