You are a scientist who is using genomics to currently study a new bacterial species that no one has ever studied before. The following sequence is a piece of DNA within the coding region of a gene that you have recently sequenced.

 

You are using shotgun sequencing to determine the DNA sequence of the genome of this new bacterial species. For one strand of a 30-nucleotide long stretch of DNA, you get the following sequences out of your shotgun sequencing reaction. Assemble the entire 30-nt-long DNA sequence

 

5’-TGGGAGTTCCTCAAACGCGTTGTCACTGAC-3’

You put the DNA sequence that you have assembled into a computer program that tells you that the following piece of DNA, which comes from another bacterium, is a close match to the sequence you have sequenced from your bacterium: 5’-…TGGGCATTTCTCAAGCGGGTTGTAATGGAT…-3’

This 30-nt-long sequence fragment lies in the center of a gene, and that portion of the sequence encodes for this 10-amino acid-long part of a protein:

N-…Trp-Ala-Phe-Leu-Lys-Arg-Val-Val-Met-Asp…-C

You hypothesize that the sequence you have discovered is another bacterial species’ version of the same gene as this previously known gene. To measure how identical the two genes are at the DNA level and/or the two proteins are at the amino acid level, you can calculate a percentage of “identity” for each. This is the percent of nucleotides (for the gene) or the percent of amino acids (for the protein) that are identical between the two sequences.

What is the % identity between the two protein sequences?

#Question id: 4808

#Section 3: Genetics, Cellular and Molecular Biology

When F1 female Drosophila of the genotype AaBbCc is test crossed, ( Gene A and B located at 10 map unit in transe configuration but gene C are independently assort for both gene. Which of the following test cross progeny that is that is more frequent?

#Question id: 4809

#Section 3: Genetics, Cellular and Molecular Biology

The upper most following figure above shows the locations of four genes on the genetic map of an organism; the lower figure shows the locations of the same four genes on a physical map derived from the nucleotide sequence of the DNA of that organism. The maps are not identical because

#Question id: 4810

#Section 3: Genetics, Cellular and Molecular Biology

In a haploid organism, the C and D loci are 8 m.u. apart. From a cross C d X c D, which of the following proportion following progeny classes: (a) C D; (b) c d; (c) C d

#Question id: 4811

#Section 3: Genetics, Cellular and Molecular Biology

Three incompletely link gene as a B-A-C order. A cross allowed between AAbbcc X aaBBCC produce f1 progeny allowed test cross. Which of the following offspring is a result of double cross over?

#Question id: 4812

#Section 3: Genetics, Cellular and Molecular Biology

Two character X and Y ,both follow law of dominance due to 3:1 F2 phenotypic ratio monohybrid cross separately If carry out dihybrid selfing cross for heterozygous genotype for both character does not follow law of independence assortment in normal environmental condition due to?

#Question id: 4813

#Section 3: Genetics, Cellular and Molecular Biology

You perform the three different two-factor crosses (Cross 1: XY and xy, Cross 2: YZ and yz, and Cross 3: XZ and xz). Assume all crosses are between diploid flies homozygous for the alleles of these genes. You observe 7% recombinants in the first cross, 20% recombinants in the second cross, and 13% recombinants in the third cross. if cross between XyZ and xYz leads to which of the followining recombinant with double cross over .