You are a scientist who is using genomics to currently study a new bacterial species that no one has ever studied before. The following sequence is a piece of DNA within the coding region of a gene that you have recently sequenced.

 

You are using shotgun sequencing to determine the DNA sequence of the genome of this new bacterial species. For one strand of a 30-nucleotide long stretch of DNA, you get the following sequences out of your shotgun sequencing reaction. Assemble the entire 30-nt-long DNA sequence

 

5’-TGGGAGTTCCTCAAACGCGTTGTCACTGAC-3’

You put the DNA sequence that you have assembled into a computer program that tells you that the following piece of DNA, which comes from another bacterium, is a close match to the sequence you have sequenced from your bacterium: 5’-…TGGGCATTTCTCAAGCGGGTTGTAATGGAT…-3’

This 30-nt-long sequence fragment lies in the center of a gene, and that portion of the sequence encodes for this 10-amino acid-long part of a protein:

N-…Trp-Ala-Phe-Leu-Lys-Arg-Val-Val-Met-Asp…-C

You hypothesize that the sequence you have discovered is another bacterial species’ version of the same gene as this previously known gene. To measure how identical the two genes are at the DNA level and/or the two proteins are at the amino acid level, you can calculate a percentage of “identity” for each. This is the percent of nucleotides (for the gene) or the percent of amino acids (for the protein) that are identical between the two sequences.

What is the % identity between the two protein sequences?

#Question id: 9583

#Section 2: General Biology

 A mechanism known as the Q cycle accounts for most of the observations in which structure and reactions of plastoquinone that operate in,

#Question id: 9585

#Section 2: General Biology

In light reaction the reaction centre of PSII  receives electron from water molecules by splitting into oxygen, If 5 oxygen molecules evolved per 50 quanta was

absorbed then what is the quantum yield?

#Question id: 9586

#Section 2: General Biology

The photochemical quantum efficiency (quantum yield) is nearly 100%, the energy conversion efficiency is only 27%, and the overall efficiency of conversion of solar

energy is only a few percent the solar energy storage efficiency is a measure of how much of the energy in the entire solar spectrum is converted to usable form, if it

can be measure in terms of C3 and C4 plant?

#Question id: 9587

#Section 2: General Biology

The structure of the four major protein complexes in the thylakoid membrane are organised form such as ;

a.) PSII is located predominantly in the stacked regions of the thylakoid membrane and Cytochrome b6f complexes are evenly distributed

b.) PSI and ATP synthase are found in the unstacked regions protruding into the stroma

c.) Lateral separation of the two photosystems requires that electrons and protons produced by PSII be transported directly to PSI and the ATP coupling enzyme

d.) Four main protein complexes of the thylakoid membrane, shown also are the two diffusible electron carriers—plastocyanin, which is located in the thylakoid lumen, and plastohydroquinone (PQH2) in the membrane, The lumen has a positive electrical charge with respect to the stroma

Which of the following statements correct?

#Question id: 9588

#Section 2: General Biology

The light-absorbing antenna systems are organised in different manner, which of the following statements about antenna would be Incorrect?

#Question id: 9589

#Section 2: General Biology

The physical mechanism by which excitation energy is conveyed from the chlorophyll that absorbs the light to the reaction centre, By this mechanism the excitation energy is transferred from one molecule to another by a nonradioactive process, this mechanism is known as