Practice Questions

TLS Online TPP Program

#Question id: 4809

The upper most following figure above shows the locations of four genes on the genetic map of an organism; the lower figure shows the locations of the same four genes on a physical map derived from the nucleotide sequence of the DNA of that organism. The maps are not identical because

#Section 3: Genetics, Cellular and Molecular Biology

There is no relationship between the position of genes in a genetic map and their positions on the DNA
recombination frequencies per kb of DNA are not uniform throughout a chromosome
the farther apart two genes are, the more likely they are to recombine
some genes contain introns

More Questions

TLS Online TPP Program

#Question id: 14113

#Section 7: Recombinant DNA technology and Other Tools in Biotechnology

SWISS-PROT is related to

TLS Online TPP Program

#Question id: 14114

#Section 7: Recombinant DNA technology and Other Tools in Biotechnology

‘A laboratory, where drugs, chemicals, and other types of biological matter can be analysed and tested by using various liquids’ is called

TLS Online TPP Program

#Question id: 14115

#Section 7: Recombinant DNA technology and Other Tools in Biotechnology

Which one of the following is a database of protein sequence motifs?

TLS Online TPP Program

#Question id: 14116

#Section 7: Recombinant DNA technology and Other Tools in Biotechnology

Which of the following statements are CORRECT when a protein sequence database is searched using the BLAST algorithm?

P. A larger E-value indicates higher sequence similarity

Q. E-value < 10^-10 indicates sequence homology

R. A higher BLAST score indicates higher sequence similarity

S. E-value > 10^10 indicates sequence homology

TLS Online TPP Program

#Question id: 14117

#Section 7: Recombinant DNA technology and Other Tools in Biotechnology

Identify the character based method used for the construction of a phylogenetic tree.

P. Maximum parsimony

Q. Neighbor joining

R. Maximum likelihood

S. Bootstrapping

TLS Online TPP Program

#Question id: 14118

#Section 7: Recombinant DNA technology and Other Tools in Biotechnology

Identify the file format given below:

>KX580312.1 Homo sapiens truncated breast cancer 1 (BRCA1) gene, exon 15 and partial cds

GTCATCCCCTTCTAAATGCCCATCATTAGATGATAGGTGGTACATGCACAGTTGCTCTGGGAGTCTTCAG

AATAGAAACTACCCATCTCAAGAGGAGCTCATTAAGGTTGTTGATGTGGAGGAGTAACAGCTGGAAGAGT

CTGGGCCACACGATTTGACGGAAACATCTTACTTGCCAAGGCAAGATCTAG