You are practicing designing primers that you can use in PCR reactions. You want your primers to allow you to amplify the sequence found below.

 

 

 (a) 5’-ACTTCGATATGTCTAAAATAC-3’ and 5’- CGGTAGCGTCTCTGGTTAGCT -3’

(b) 5’-TGAAGCTATACAGATTTTATG-3’ and 5’-GCCATCGCAGAGACCAATCGA-3’

(c) 5’-GTATTTTAGACATATCGAAGT -3’ and 5’-AGCTAACCAGAGACGCTACCG-3’

Find the correct band pattern in gel lanes what size(s) of PCR products you would get if you used the following primers stated in parts (a), (b), and (c) to do a PCR reaction on the template DNA shown above.

#Question id: 14265

#Section 5: Bioprocess Engineering and Process Biotechnology

#Question id: 14266

#Section 5: Bioprocess Engineering and Process Biotechnology

#Question id: 14267

#Section 5: Bioprocess Engineering and Process Biotechnology

In a trickling biological filter, the BOD value of the feed stream is S_0i = 500 mg/l with a feed flow of F = 10³ l/h. The effluent BOD value is desired to be S₀ = 10 mg/l. The following kinetic parameters for the biocatalysts are known: r_m = 20 mg/S/l .h and K_s = 200 mg S/l. The biofilm thickness is L = 0.1 mm. The cross-sectional area of the filter is A = 2 m² , and the biofilm surface area per unit volume of the bed is a = 500 cm² /cm³ . Assume that dissolved oxygen is the rate-limiting substrate and the diffusion coefficient of oxygen is D_O2 = 2 × 10^-5 cm² /s. Determine the required height of the bed. You can assume first-order bioreaction kinetics?

_____________________

#Question id: 14268

#Section 5: Bioprocess Engineering and Process Biotechnology

An activated-sludge waste treatment system is required to reduce the amount of BOD₅ from 1000 mg/l to 20 mg/l at the exit. The sedimentation unit concentrates biomass by a factor of 3. Kinetic parameters are µ_m = 0.2 h-1 , K_s = 80 mg/l, k_d = 0.01 h-1 , and Y ^M _X/S = 0.5 g MLVSS/g BOD₅. The flow of waste water is 10000 l/h and the size of the treatment basin is 50,000 l. What is the value of the solids residence time?

#Question id: 14269

#Section 5: Bioprocess Engineering and Process Biotechnology

An activated-sludge waste treatment system is required to reduce the amount of BOD₅ from 1000 mg/l to 20 mg/l at the exit. The sedimentation unit concentrates biomass by a factor of 3. Kinetic parameters are µ_m = 0.2 h-1 , K_s = 80 mg/l, k_d = 0.01 h-1 , and Y ^M _X/S = 0.5 g MLVSS/g BOD₅. The flow of waste water is 10000 l/h and the size of the treatme nt basin is 50,000 l. What value of the recycle ratio must be used?

________________________