During initial stages of vertebrate cleavage, successive blastomeres

TLS Online TPP Program

#Question id: 13093

#SCPH01 Biochemistry

You are studying a specific gene in yeast, and you want to express that yeast gene in E. coli. Your task is to design a strategy to insert the yeast gene into the bacterial plasmid. Below is a map of the area of the yeast genome surrounding the gene in which you are interested.

 

The distance between each tick mark placed on the line above is 100 bases in length

Below are the enzymes you can use, with their specific cut sites shown 5’-XXXXXX-3’ 3’-XXXXXX-5’

 

The plasmid is 5,000 bases long and the two farthest restriction enzyme sites are 200 bases apart. The plasmid has an ampicillin resistance gene somewhere on the plasmid distal from the restriction cut sites.

                                    

You transform your ligation planned in which two restriction enzymes would you use to design a way to get the insert into the vector if you had to use two enzymes simultaneously, into bacteria and plate the bacteria on Petri plates containing ampicillin. (You actually transform six different ligation mixtures, which are described below, into six different populations of cells, and plate each transformation onto a different plate, because you want to do all of the correct controls.) The next day you come in to lab to look at how many colonies of bacteria are on each plate. You are really excited, because the number of colonies you see on each plate tells you that the entire procedure worked! Which of the three following patterns of number of colonies did you see in order to conclude that you had a successful transformation?

In this table, DV = digested vector. DYG = digested yeast genome.

 

TLS Online TPP Program

#Question id: 13042

#SCPH06 I Botany

For analyzing DNA sequences, two techniques have been developed, one is _________ method frequently termed_________, involving the enzymatic synthesis of DNA and stopping the synthesis at specific nucleotides. While another technique, the __________ method of DNA sequencing developed by ___________ is often used for sequencing small fragments of DNA.

TLS Online TPP Program

#Question id: 11595

#I Life Science/ Life Sciences Group – I-V

Paclobutrazol and other inhibitors of P450 monooxygenases specifically inhibit the stage of gibberellin biosynthesis

TLS Online TPP Program

#Question id: 14118

#I Life Science/ Life Sciences Group – I-V

Identify the file format given below:

>KX580312.1 Homo sapiens truncated breast cancer 1 (BRCA1) gene, exon 15 and partial cds

GTCATCCCCTTCTAAATGCCCATCATTAGATGATAGGTGGTACATGCACAGTTGCTCTGGGAGTCTTCAG

AATAGAAACTACCCATCTCAAGAGGAGCTCATTAAGGTTGTTGATGTGGAGGAGTAACAGCTGGAAGAGT

CTGGGCCACACGATTTGACGGAAACATCTTACTTGCCAAGGCAAGATCTAG

TLS Online TPP Program

#Question id: 3657

#SCPH01 Biochemistry

Mutations in excision repair genes or a translesion DNA polymerase cause: