TLS Online TPP Program

#Question id: 13095


You are practicing designing primers that you can use in PCR reactions. You want your primers to allow you to amplify the sequence found below.
 

 
 (a) 5’-ACTTCGATATGTCTAAAATAC-3’ and 5’- CGGTAGCGTCTCTGGTTAGCT -3’
(b) 5’-TGAAGCTATACAGATTTTATG-3’ and 5’-GCCATCGCAGAGACCAATCGA-3’
(c) 5’-GTATTTTAGACATATCGAAGT -3’ and 5’-AGCTAACCAGAGACGCTACCG-3’
Find the correct band pattern in gel lanes what size(s) of PCR products you would get if you used the following primers stated in parts (a), (b), and (c) to do a PCR reaction on the template DNA shown above.

#SCPH06 I Botany
  1. -
  2. -
  3. -
  4. -
More Questions
TLS Online TPP Program

#Question id: 5133

#SCPH01 Biochemistry

Identify the correct ligands in both receptor serine kinase pathway.

 

TLS Online TPP Program

#Question id: 5134

#SCPH01 Biochemistry

Match the following cleavage patterns with the species in which they occur.

        Species                                           Cleavage Pattern

      A. Flatworm                                       i. Meroblastic discoidal

      B. Frog                                               ii. Meroblastic superficial

      C. Birds                                              iii. Holoblastic displaced radial

      D. Insect                                              iv. Holoblastic spiral

TLS Online TPP Program

#Question id: 5135

#SCPH01 Biochemistry

In xenopus, result of tissue transplantation during early and late gastrulae

(A) Cells of early newt gastrula exhibit conditional development.

(B) Cells of early newt gastrula exhibit autonomous development

(C) Cells of late newt gastrula exhibit conditional development.

(D) Cells of late gastrula exhibit autonomous development.

The correct inferences are:

TLS Online TPP Program

#Question id: 5136

#SCPH01 Biochemistry

Some statements regarding to hippo pathway.

A. The Hippo signal transduction pathway have a dedicated ligand or receptor

B. Hippo stands for one of several important kinases that are critical for organ size control

C. It was first identified in Drosophila, where its loss resulted in a “hippopotamus”-shaped phenotype due to excessive growth

D. Gain of Hippo causes cells to divide significantly faster while slowing apoptosis

E. overexpression of its main transcriptional effector, Yorkie causes cells to divide significantly faster while slowing apoptosis

Which of the following combination are incorrect?

TLS Online TPP Program

#Question id: 5199

#SCPH06 I Botany

For mapping studies of genomes, most of which were far along before 2000, the 3 -stage method was often used. Which is the usual order in which the stages were performed, assuming some overlap of the three?

TLS Online TPP Program

#Question id: 5199

#SCPH28 | Zoology

For mapping studies of genomes, most of which were far along before 2000, the 3 -stage method was often used. Which is the usual order in which the stages were performed, assuming some overlap of the three?