In carrot, which Nitrogen Source is essential during SE induction?

TLS Online TPP Program

#Question id: 12135

#Unit 10. Ecological Principles

Which of the following is an example of Batesian mimicry?

TLS Online TPP Program

#Question id: 13100

#Unit 13. Methods in Biology

 You are a scientist who is using genomics to currently study a new bacterial species that no one has ever studied before. The following sequence is a piece of DNA within the coding region of a gene that you have recently sequenced.

 

You are using shotgun sequencing to determine the DNA sequence of the genome of this new bacterial species. For one strand of a 30-nucleotide long stretch of DNA, you get the following sequences out of your shotgun sequencing reaction. Assemble the entire 30-nt-long DNA sequence

  

5’-TGGGAGTTCCTCAAACGCGTTGTCACTGAC-3’

You put the DNA sequence that you have assembled into a computer program that tells you that the following piece of DNA, which comes from another bacterium, is a close match to the sequence you have sequenced from your bacterium: 5’-…TGGGCATTTCTCAAGCGGGTTGTAATGGAT…-3’

This 30-nt-long sequence fragment lies in the center of a gene, and that portion of the sequence encodes for this 10-amino acid-long part of a protein: 

N-…Trp-Ala-Phe-Leu-Lys-Arg-Val-Val-Met-Asp…-C

You hypothesize that the sequence you have discovered is another bacterial species’ version of the same gene as this previously known gene. To measure how identical the two genes are at the DNA level and/or the two proteins are at the amino acid level, you can calculate a percentage of “identity” for each. This is the percent of nucleotides (for the gene) or the percent of amino acids (for the protein) that are identical between the two sequences.

What is the % identity between the two DNA sequences?

TLS Online TPP Program

#Question id: 2103

#Unit 2. Cellular Organization

When a plant cell, such as one from a tulip leaf, is submerged in a hypertonic solution, what is likely to occur?

TLS Online TPP Program

#Question id: 3541

#Unit 8. Inheritance Biology

Blue follower is dominant over white flower and long pollen is dominant over short pollen. A plant with Blue flower and short pollen was cross with white flower and long pollen. All F1 offspring display blue flower and long pollen. What is the percent of F2 progeny showing blue flower and long pollen?

TLS Online TPP Program

#Question id: 19084

#Unit 4. Cell Communication and Cell Signaling

ToxA is produced by__

a) Cochliobolus carbonum

b) Stagonospora nodorum

c) Pyrenophora tritici‐repentis

d) fungus Botrytis

Which combination is correct?