Biomagnification occurs mainly because of the following reasons

I. compounds are taken up from the environment and accumulated in the lipid deposits of body

II. organisms are consumed by other organisms in a non- sequential manner constituting the food chain

Which of the above statements are incorrect?

TLS Online TPP Program

#Question id: 4211

#Unit 3. Fundamental Processes

If the following eukaryotic mRNA were properly modified and sent to the cytoplasm, what size protein (in amino acids) would it encode? 

5’UCAGGACCUUAUGGACCAUUGCUGGGACCUUUGAGUGCUGUACCAUAGUUAAAGAUAGCCAUC 3’

TLS Online TPP Program

#Question id: 11061

#Unit 7. System Physiology – Animal

The pleural pressure of a normal 56-year-old woman is approximately −5 cm H2O during resting conditions immediately before inspiration (i.e., at functional residual capacity). What is the pleural pressure (in cm H2O) during inspiration?

TLS Online TPP Program

#Question id: 26526

#Unit 3. Fundamental Processes

YSPTSPS repeats in CTD corresponds to the complexity of the genome. Which of the is correctly  representing the complexity(x-axis) vs no of repeat (y-axis)

TLS Online TPP Program

#Question id: 5944

#General Aptitude

What was the day of the year of the week on 30 January 2006 ?

TLS Online TPP Program

#Question id: 24473

#Unit 3. Fundamental Processes

The CTD contains a series of repeats of the heptapeptide sequence: Tyr-Ser-Pro-Thr-Ser-Pro-Ser. In which