Which of the following processes includes all of the others?

TLS Online TPP Program

#Question id: 12473

#Unit 10. Ecological Principles

You are observing a population of lizards when you notice that the number of adults has increased and is higher than previously observed. One explanation for such an observation would include

TLS Online TPP Program

#Question id: 13095

#Unit 13. Methods in Biology

You are practicing designing primers that you can use in PCR reactions. You want your primers to allow you to amplify the sequence found below.

 

 

 (a) 5’-ACTTCGATATGTCTAAAATAC-3’ and 5’- CGGTAGCGTCTCTGGTTAGCT -3’

(b) 5’-TGAAGCTATACAGATTTTATG-3’ and 5’-GCCATCGCAGAGACCAATCGA-3’

(c) 5’-GTATTTTAGACATATCGAAGT -3’ and 5’-AGCTAACCAGAGACGCTACCG-3’

Find the correct band pattern in gel lanes what size(s) of PCR products you would get if you used the following primers stated in parts (a), (b), and (c) to do a PCR reaction on the template DNA shown above.

TLS Online TPP Program

#Question id: 32287

#Unit 2. Cellular Organization

Which of the following ER resident protein catalyzes the oxidation of free sulfhydryl (SH) groups on cysteines?

TLS Online TPP Program

#Question id: 18645

#Unit 13. Methods in Biology

SDS PAGE separate molecules by size because the presence of SDS (sodium dodecyl sulphate) denatures the protein removing 2˚, 3˚ and 4˚ structures (they assume a linear chain) and the SDS coats the molecules giving them a uniform charge/mass ratio. In an experiment (SDS-PAGE) with a discontinuous buffer system following band pattern is obtained 

   

Choose the correct statement regarding this band pattern

TLS Online TPP Program

#Question id: 23571

#Unit 8. Inheritance Biology

In an individual heterozygous, the abnormal chromosome loops out during chromosome pairing in prophase I, in which condition?