TLS Online TPP Program

#Question id: 19208


Nicotinic acid detection in whole cell biosensor can be done using 

#Unit 12. Applied Biology
  1. E.Coli
  2. Lactobacillus arabinosus
  3. Streptococcus aureus
  4. Bacillus subtilis
More Questions
TLS Online TPP Program

#Question id: 12720

#Unit 6. System Physiology – Plant

Several genes coding for enzymes associated with osmotic adjustment are turned on (up-regulated) by osmotic stress and/or salinity, and cold stress. These genes encode enzymes such as the following;
I) ∆′1-Pyrroline-5-carboxylate synthase, a key enzyme in the proline biosynthetic pathway
II) myo-Inositol 6-O-methyltransferase, a rate-limiting enzyme in the accumulation of the cyclic sugar alcohol called pinitol
III) Betaine aldehyde dehydrogenase, an enzyme involved in glycine betaine accumulation
Given following statements of gene encoding enzyme is correct?

TLS Online TPP Program

#Question id: 13055

#Unit 13. Methods in Biology

Precision will be reduced, but yield will be increased
Optimisation of a PCR reaction is often a compromise between the competing demands for precision, efficiency and yield. Although the specific effects may vary, generally, increasing the annealing temperature will increase non-specific primer binding and reduce precision. Increasing the length of the elongation phase will reduce the proportion of incomplete newly-synthesised strands and therefore increase yield. In this case, the potential effect on efficiency is unclear. Increasing the elongation phase would increase the reaction time, but the time taken to ramp down to a lower annealing temperature would be reduced.
Which of the following will provide least specific amplification in qPCR?

TLS Online TPP Program

#Question id: 33308

#Unit 1. Molecules and their Interaction Relevant to Biology

If the inhibitor binds to a different site from the substrate and reduces the affinity of the enzyme for the substrate without altering the reaction characteristics of that substrate which does bind, then it is called as

TLS Online TPP Program

#Question id: 13095

#Unit 13. Methods in Biology

You are practicing designing primers that you can use in PCR reactions. You want your primers to allow you to amplify the sequence found below.
 

 
 (a) 5’-ACTTCGATATGTCTAAAATAC-3’ and 5’- CGGTAGCGTCTCTGGTTAGCT -3’
(b) 5’-TGAAGCTATACAGATTTTATG-3’ and 5’-GCCATCGCAGAGACCAATCGA-3’
(c) 5’-GTATTTTAGACATATCGAAGT -3’ and 5’-AGCTAACCAGAGACGCTACCG-3’
Find the correct band pattern in gel lanes what size(s) of PCR products you would get if you used the following primers stated in parts (a), (b), and (c) to do a PCR reaction on the template DNA shown above.

TLS Online TPP Program

#Question id: 28589

#Unit 2. Cellular Organization

which of the following Cyclin–CDKs of G1 phase specifically belongs to budding yeast?