TLS Online TPP Program
More Questions
TLS Online TPP Program
#Question id: 13100
#Unit 13. Methods in Biology
You are a scientist who is using genomics to currently study a new bacterial species that no one has ever studied before. The following sequence is a piece of DNA within the coding region of a gene that you have recently sequenced.
You are using shotgun sequencing to determine the DNA sequence of the genome of this new bacterial species. For one strand of a 30-nucleotide long stretch of DNA, you get the following sequences out of your shotgun sequencing reaction. Assemble the entire 30-nt-long DNA sequence
5’-TGGGAGTTCCTCAAACGCGTTGTCACTGAC-3’
You put the DNA sequence that you have assembled into a computer program that tells you that the following piece of DNA, which comes from another bacterium, is a close match to the sequence you have sequenced from your bacterium: 5’-…TGGGCATTTCTCAAGCGGGTTGTAATGGAT…-3’
This 30-nt-long sequence fragment lies in the center of a gene, and that portion of the sequence encodes for this 10-amino acid-long part of a protein:
N-…Trp-Ala-Phe-Leu-Lys-Arg-Val-Val-Met-Asp…-C
You hypothesize that the sequence you have discovered is another bacterial species’ version of the same gene as this previously known gene. To measure how identical the two genes are at the DNA level and/or the two proteins are at the amino acid level, you can calculate a percentage of “identity” for each. This is the percent of nucleotides (for the gene) or the percent of amino acids (for the protein) that are identical between the two sequences.
What is the % identity between the two DNA sequences?
TLS Online TPP Program
#Question id: 64
#Unit 1. Molecules and their Interaction Relevant to Biology
Testosterone and estradiol are male and female sex hormones, respectively, in many vertebrates. In what way(s) do these molecules differ from each other? Testosterone and estradiol ________.
TLS Online TPP Program
#Question id: 19078
#Unit 6. System Physiology – Plant
Avirulence (Avr) genes, they are recognized by a cognate resistance gene. The Pseudomonas AvrPto effector causes avirulence on tomato (Solanum lycopersicum) because they carry__
TLS Online TPP Program
#Question id: 12568
#Unit 10. Ecological Principles
Which of the following would a landscape ecologist consider in designing a nature reserve?
TLS Online TPP Program
#Question id: 19081
#Unit 4. Cell Communication and Cell Signaling
Oomycetes (fungus‐like organisms), brown algae and mammalian parasites as Plasmodium falciparum and fungi can be__
a) Biotrophic plant pathogens
b) Necrotrophic plant pathogens
c) Hemibiotrophic plant pathogens